ID: 1038900377

View in Genome Browser
Species Human (GRCh38)
Location 8:31835680-31835702
Sequence TGTGGTTGAAATGAATAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 252}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038900377_1038900380 2 Left 1038900377 8:31835680-31835702 CCTTGCTATTCATTTCAACCACA 0: 1
1: 0
2: 5
3: 25
4: 252
Right 1038900380 8:31835705-31835727 ACAAGTATAAACATGTACAAGGG No data
1038900377_1038900381 7 Left 1038900377 8:31835680-31835702 CCTTGCTATTCATTTCAACCACA 0: 1
1: 0
2: 5
3: 25
4: 252
Right 1038900381 8:31835710-31835732 TATAAACATGTACAAGGGAGAGG No data
1038900377_1038900379 1 Left 1038900377 8:31835680-31835702 CCTTGCTATTCATTTCAACCACA 0: 1
1: 0
2: 5
3: 25
4: 252
Right 1038900379 8:31835704-31835726 TACAAGTATAAACATGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038900377 Original CRISPR TGTGGTTGAAATGAATAGCA AGG (reversed) Intronic
900720322 1:4171839-4171861 TGTGGGTGAAATGCCTCGCATGG - Intergenic
902348665 1:15837164-15837186 TGTGGTGGAAATTATTACCAGGG + Intergenic
904657774 1:32062353-32062375 TGTGTTTGAAATGCCTGGCATGG + Intergenic
908995124 1:70142428-70142450 TCTGTTTGAAATGAAGAGAAAGG + Intronic
909001247 1:70220385-70220407 TGAGGTTGAAAACAAAAGCAAGG + Intronic
909148119 1:71964299-71964321 TGTGGTTGAAATGACGAGGCAGG + Intronic
909345624 1:74582784-74582806 TGTGGTTTAAATGAATATTTTGG + Intronic
909503660 1:76363074-76363096 TGTGGTAGAAAAGAAAAGCCTGG - Intronic
914220592 1:145678508-145678530 TGTGGTAGAAATGATTAGAAAGG - Exonic
914473171 1:148001378-148001400 TGTGGTAGAAATGATTAGAAAGG - Intergenic
916385488 1:164262937-164262959 TGTGGGTGAAATGAAGAAGAAGG - Intergenic
916408606 1:164522815-164522837 TGTGGATGAAAAGAACATCATGG + Intergenic
916457306 1:164984054-164984076 TCCAGTTGAAATGAATAGCAGGG - Intergenic
917430179 1:174958666-174958688 TGTTGCTGAATTGAATAGCATGG + Intronic
917483359 1:175432337-175432359 TGTGGTTAGAAGTAATAGCAGGG + Intronic
918194713 1:182210414-182210436 TGGTTTTGAAATGAAAAGCATGG + Intergenic
920672712 1:208016739-208016761 TGGAGTTGAAATGAAAACCAAGG + Intergenic
923040210 1:230314377-230314399 GTTGCTGGAAATGAATAGCAAGG - Intergenic
923476630 1:234339185-234339207 TGTGGTTGGAAAGAATAGTTTGG - Intergenic
923549007 1:234946575-234946597 TGTGATTGGAAAGAATAGCAAGG + Intergenic
923910857 1:238442221-238442243 AGTAGTTGAAATGAAGAGGAAGG + Intergenic
1063927583 10:10995699-10995721 TCTGGCTGAAATGTGTAGCATGG + Intergenic
1066317734 10:34265078-34265100 TGTGTTTGATATGAATAACAAGG - Intronic
1066740003 10:38511261-38511283 TGTAGTCGAAATGAATAGAATGG + Intergenic
1066741996 10:38526393-38526415 TGCAATTGAAATGAATAGAATGG + Intergenic
1069150778 10:64956482-64956504 TATGGTTGAAATGTATTCCATGG - Intergenic
1069230545 10:66004062-66004084 TCAGTTTCAAATGAATAGCAAGG + Intronic
1072381341 10:94874507-94874529 TTTGTTTTAAATGACTAGCATGG + Intergenic
1072996140 10:100245867-100245889 TTTGATTTAAATGAAAAGCAGGG - Exonic
1075305577 10:121364825-121364847 TGTGGTTCAAATCAAATGCAAGG + Intergenic
1075981277 10:126742166-126742188 TGTGGATGAAATAAATAGATGGG - Intergenic
1076144779 10:128108802-128108824 TCTGGTTGTAATGACTGGCAGGG + Exonic
1076371402 10:129958283-129958305 TATAGTTGCAAGGAATAGCAAGG - Intronic
1078359393 11:10656848-10656870 TGTGGCAGAAAAGACTAGCACGG + Intronic
1086472374 11:87129138-87129160 TGTAGTTGAAAGGAGCAGCAAGG + Intronic
1088264241 11:107974442-107974464 TGTGCTTGAACTCAACAGCATGG - Intergenic
1093360425 12:18219751-18219773 TGTGGTTAAAATGATTACCTGGG + Intronic
1093421915 12:18983594-18983616 TGTGGTCTTAATGATTAGCATGG - Intergenic
1094197561 12:27765231-27765253 TGTAGTTGAAATGAAGAGAAGGG - Intronic
1094272548 12:28632983-28633005 TGTGGTTGTAAAGAAAGGCAGGG - Intergenic
1094828912 12:34290947-34290969 TGTGGAAGAAAAAAATAGCACGG - Intergenic
1097951424 12:65433429-65433451 TGTGGTTGCACTGAATACCATGG - Intronic
1098462682 12:70750286-70750308 TGCCGTAGAAATGAAAAGCATGG - Intronic
1098907072 12:76173098-76173120 TGTGGTTGAAATGGATGGTAAGG + Intergenic
1099112745 12:78582848-78582870 TGTGGTGGAAATCAAGAGGAAGG - Intergenic
1099873488 12:88376344-88376366 TGTGATTAAAAGGATTAGCATGG - Intergenic
1100779168 12:98006018-98006040 TGAGGATCAAATGAATAGTATGG + Intergenic
1102533693 12:113565569-113565591 TGTTGTTGAAATCACTACCAGGG - Intergenic
1102888511 12:116539580-116539602 TGTGTTTGAAATGCATTGCAGGG - Intergenic
1105914608 13:24901689-24901711 TGTTGTTGAAATGAAAAGCAAGG + Intronic
1106176127 13:27333601-27333623 TGTGCTTAAAATGCATAGAAAGG - Intergenic
1106323854 13:28669217-28669239 AGTGGGTTAAATAAATAGCAGGG - Intronic
1106627738 13:31438049-31438071 TGTGATTCAAATTGATAGCAGGG - Intergenic
1108881632 13:55127010-55127032 TGTGGTTTAAAGATATAGCATGG - Intergenic
1109362717 13:61316891-61316913 TTTGGCTGAGATGAACAGCAAGG + Intergenic
1110608189 13:77458261-77458283 TGCTGTTAAAATTAATAGCAAGG + Intergenic
1114056450 14:18971871-18971893 TGGAATTGAAATGAATAGCATGG - Intronic
1114106100 14:19429856-19429878 TGGAATTGAAATGAATAGCATGG + Intronic
1114219920 14:20687223-20687245 TTTTGTTGAAATGAAAAGTAGGG - Intronic
1114916560 14:27274473-27274495 TCTGGTTGAAATAAATATGAGGG + Intergenic
1115340203 14:32285672-32285694 ACTGGTTTAAATGAATAGGAAGG + Intergenic
1115527794 14:34299065-34299087 TCTGGATGCAAGGAATAGCAGGG + Intronic
1117243610 14:53861168-53861190 TGTGGCAGAAATAAATACCATGG - Intergenic
1117736648 14:58774907-58774929 TGTGGGCCAAATGAAGAGCATGG + Intergenic
1118973066 14:70653715-70653737 TGTCTTTGAAATGAAAAGCAGGG + Intronic
1120191194 14:81441321-81441343 TGTACTTGAAATCAATAACATGG + Intergenic
1121745895 14:96291910-96291932 TATGTTTGAAATGAAGTGCAAGG - Intronic
1123498964 15:20862370-20862392 TGAAATTCAAATGAATAGCATGG + Intronic
1123556200 15:21435989-21436011 TGAAATTCAAATGAATAGCATGG + Intronic
1123592440 15:21873335-21873357 TGAAATTCAAATGAATAGCATGG + Intergenic
1124049176 15:26179069-26179091 TCTGCTTGAAATGATTAGCATGG - Intergenic
1126390992 15:48151904-48151926 TCTGGAAGCAATGAATAGCATGG - Exonic
1126539595 15:49807117-49807139 TGAGGTTGAAAGGAATACTAAGG - Intergenic
1127316553 15:57800279-57800301 TGAGGATCAAATGTATAGCATGG - Intergenic
1128687575 15:69698257-69698279 TGTGGTTGAAATTATCAGAATGG + Intergenic
1130243043 15:82215158-82215180 TGTGGTTCACATAAATAACAAGG - Intronic
1131098766 15:89672136-89672158 AGTGGTTAAAAAGAAGAGCATGG - Intronic
1132137394 15:99355314-99355336 AGTGATGGAAATGTATAGCATGG + Intronic
1202964541 15_KI270727v1_random:163192-163214 TGAAATTCAAATGAATAGCATGG + Intergenic
1133381520 16:5334902-5334924 TGAGGCTGTAATGAGTAGCATGG + Intergenic
1140810315 16:78570809-78570831 TGGGCTGGAAATGAATGGCAGGG + Intronic
1140969240 16:79996985-79997007 TGGGGCGGAAATGAATATCAGGG + Intergenic
1143994546 17:10995424-10995446 TGTGTTTGAAATATTTAGCATGG - Intergenic
1145047928 17:19633404-19633426 TGTGGATGGAAAGAATATCAGGG + Intergenic
1145335222 17:21906775-21906797 TGGAGTTGAAAAGAATAGAATGG + Intergenic
1145699954 17:26821736-26821758 TATAATTGAAATGAATAGAATGG + Intergenic
1146096116 17:29931420-29931442 TGTGGTTGAAATAATTAGCAGGG + Intronic
1149294744 17:55251957-55251979 TGAGGGTAAAACGAATAGCAGGG + Intergenic
1149450700 17:56747943-56747965 AGTGGTTTAAATGAATAATAAGG - Intergenic
1151308682 17:73280207-73280229 TGGGGGTGATATGAATGGCATGG + Intergenic
1151609638 17:75164209-75164231 TGTGTTTGAGATGCCTAGCATGG - Intronic
1203193551 17_KI270729v1_random:211182-211204 TGTAATTGAAATGAATGGAATGG + Intergenic
1203202915 17_KI270730v1_random:10612-10634 TGTAATTGAAATGAATGGAATGG + Intergenic
1153316448 18:3727276-3727298 TGTGTTTGGAGTGAAGAGCATGG + Intronic
1154457006 18:14539116-14539138 TGAAATTCAAATGAATAGCATGG + Intronic
1158377831 18:56891896-56891918 TGTGGTTGAAATGAGAAATAAGG - Intronic
1159692684 18:71509479-71509501 TGTAGGGGAAATGAAAAGCAAGG - Intergenic
1159743628 18:72205322-72205344 TTTGGGTGAAATCAATCGCAAGG + Intergenic
1164833209 19:31339120-31339142 GGTGGTAGAAATGAATCTCAGGG - Intronic
925955233 2:8957060-8957082 TGTGGATGAAATGTATAGACTGG + Intronic
926834681 2:17005197-17005219 TGGAGTTGAAATCAAGAGCAAGG - Intergenic
928949430 2:36801307-36801329 TGAGGTTAAAGTGAGTAGCAGGG - Exonic
930426055 2:51214188-51214210 TGGGGCTGAACTGAATAGCAAGG - Intergenic
932163418 2:69483644-69483666 TGTGGTTGAATTGATTATCTTGG - Intronic
932282911 2:70510059-70510081 TGGGAGTGAAATCAATAGCATGG - Intronic
932895708 2:75637609-75637631 TGTGGTTGAAATGAGCAGCAGGG - Intergenic
933914796 2:86978891-86978913 TGTGTTTCAAATGTATAGCTAGG + Intronic
934008198 2:87791009-87791031 TGTGTTTCAAATGTATAGCTAGG - Intronic
934586656 2:95504946-95504968 TCTGTTTGAAATTAAAAGCAAGG + Intergenic
935771835 2:106431949-106431971 TGTGTTTCAAATGTATAGCTAGG - Intronic
935908236 2:107863992-107864014 TGTGTTTCAAATGTATAGCTAGG + Intronic
935994643 2:108756223-108756245 TGTGTTTCAAATGTATAGCTAGG + Intronic
936130025 2:109829114-109829136 TGTGTTTCAAATGTATAGCTAGG + Intronic
936214672 2:110542371-110542393 TGTGTTTCAAATGTATAGCTAGG - Intronic
936423809 2:112396934-112396956 TGTGTTTCAAATGTATAGCTAGG - Intronic
938158736 2:128964397-128964419 CATTGTTGAAATGAAAAGCAAGG + Intergenic
938285856 2:130116190-130116212 TGGAATTCAAATGAATAGCATGG + Intronic
938336500 2:130504756-130504778 TGGAATTCAAATGAATAGCATGG + Intronic
938353323 2:130615906-130615928 TGGAATTCAAATGAATAGCATGG - Intronic
938429749 2:131222712-131222734 TGGAATTCAAATGAATAGCATGG - Intronic
938474572 2:131595896-131595918 TGGAATTCAAATGAATAGCATGG - Intergenic
938960838 2:136340017-136340039 TATTGTTGAAATGAATACAAAGG + Intergenic
939874939 2:147567036-147567058 TGGGGCTGAAATGAATTGCTAGG - Intergenic
939886744 2:147689488-147689510 TCTGGTTAAAATGATTATCATGG - Intergenic
940165137 2:150762300-150762322 TGGGGTTGAAGTGAAGAACAAGG + Intergenic
941166295 2:162086594-162086616 CCTGGTTGAAAAGGATAGCAAGG + Intergenic
942516808 2:176762596-176762618 AGTCTTTGAAATGAATAGAATGG - Intergenic
942762285 2:179413395-179413417 TCTGGTTTAAATTAATAGCACGG + Intergenic
943686912 2:190828177-190828199 TGGGTTTGAAATGAAAATCATGG - Intergenic
944322054 2:198357741-198357763 GTTGGTTGAAATGAATAACTAGG - Intronic
945540507 2:211080838-211080860 TGGGGTTGAAATGAATGGCAGGG + Intergenic
945696072 2:213106239-213106261 TGTGGTTGAAAAGAAAATTATGG + Intronic
946637896 2:221750646-221750668 TGTGGTTGAACTGAAAGGCTGGG - Intergenic
948157939 2:235799739-235799761 TGTGTCTGAAATGAAGAGCTGGG + Intronic
948192382 2:236069953-236069975 TGTCATTGACATGAATGGCATGG + Intronic
948683262 2:239652294-239652316 TGTGGTTTAAAAAGATAGCATGG + Intergenic
1168888322 20:1275858-1275880 TGAGGTAGAAAGGAATGGCAGGG - Intronic
1169549133 20:6684273-6684295 TGTGGAAGAAGTAAATAGCAAGG + Intergenic
1171920001 20:31090850-31090872 TGTTCTTGAATTGAATAGAATGG + Intergenic
1171928499 20:31209009-31209031 TGTTCTTGAATTGAATAGAATGG + Intergenic
1173465891 20:43281026-43281048 AGTGATTTAAATGAATAACATGG - Intergenic
1176525676 21:7916139-7916161 TGTAATTGAAAGGAATAGAATGG - Intergenic
1176746205 21:10654824-10654846 TGGAGTTGAAAGGAATAGAATGG - Intergenic
1176817153 21:13614221-13614243 TGAAATTCAAATGAATAGCATGG - Intronic
1177389543 21:20450421-20450443 TTCGGTTGGATTGAATAGCATGG - Intergenic
1178172058 21:30052282-30052304 TGTGGTTTAAAAAAAAAGCAGGG + Intergenic
1179268226 21:39824734-39824756 TGTGTTTGAAATGAGTATCATGG + Intergenic
1180474936 22:15694482-15694504 TGGAATTGAAATGAATAGCATGG - Intronic
1183495534 22:38141413-38141435 TGTGGTTGTAATGAACCTCATGG - Intronic
1203296990 22_KI270736v1_random:50395-50417 TGTGGTGGAAATGAATGGAATGG + Intergenic
949470926 3:4395671-4395693 TGTGGGTGAAACAAGTAGCATGG - Intronic
950157310 3:10731531-10731553 GGTAGTGGTAATGAATAGCAGGG + Intergenic
951043117 3:18010183-18010205 TGTGGTTGAAGTAAAGAGAAAGG - Intronic
951416485 3:22429623-22429645 TGTGGTTGGAAGGAATACCTTGG - Intergenic
953484269 3:43280117-43280139 TGTGCATGAATTGAAAAGCAAGG - Intergenic
955115968 3:56002249-56002271 TATGGAGAAAATGAATAGCATGG - Intronic
957594011 3:82237119-82237141 AGTGGTTTAAATGAATAATATGG - Intergenic
957680767 3:83430837-83430859 TGTGGTAGTTATGAACAGCAAGG - Intergenic
959819335 3:110713770-110713792 TGTGGTTTAAATGCAGAACAAGG + Intergenic
960235747 3:115280087-115280109 TTTGGTTGAAATGAATATAGAGG + Intergenic
960314312 3:116157453-116157475 TTTGGATGAACTGATTAGCAAGG - Intronic
960321097 3:116237588-116237610 TGTGGTGAAAATGAATAAAAGGG - Intronic
960328306 3:116324450-116324472 TGTGGATATAATGATTAGCAAGG + Intronic
960894872 3:122493028-122493050 TTTGGTTGAGATGATTAGAAAGG + Intronic
962049795 3:131800884-131800906 TGTGGGTGAAAAGAAGGGCATGG + Intronic
962557322 3:136567357-136567379 TGTGGCTGAATTGTAGAGCATGG - Intronic
963223050 3:142832191-142832213 GGTGGTAGAAATGAAGAGGAGGG - Intronic
963241179 3:143003996-143004018 TGTGTTAGAAATAAAAAGCAGGG - Intronic
964187847 3:153967735-153967757 TCTGGATGGAATAAATAGCAAGG - Intergenic
965397774 3:168181009-168181031 TGAGGTTGAGATGGATAGGAAGG - Intergenic
966138331 3:176726525-176726547 TTAGGTTGAACTGAATAGAAAGG + Intergenic
966431039 3:179832007-179832029 TCTGGTTGAAATGAGGAGAATGG + Intronic
967225379 3:187286102-187286124 TGTGATTGAGATGAATGGCAGGG - Intronic
971971357 4:33624505-33624527 TGGAGATGAAATCAATAGCATGG + Intergenic
972023071 4:34339200-34339222 TATTGTTGAAATGAAAACCAAGG + Intergenic
972798157 4:42443663-42443685 TGTGGCTGAACTGTAGAGCAAGG + Exonic
973226280 4:47788738-47788760 TGTGGTTGTAATGAATATATAGG + Intronic
973800600 4:54473906-54473928 TGTGGTGGAGCTGAATGGCATGG + Intergenic
974016236 4:56651825-56651847 TGTGCTTGAATTGAAGAGAAAGG + Intronic
974137764 4:57840176-57840198 TGGGGATGAAATGAATATAATGG + Intergenic
976106674 4:81626426-81626448 TGTAGTTGAAATGAGATGCAGGG + Intronic
979717516 4:123859220-123859242 TGGAGTTGAAATGTATATCAGGG + Intergenic
980102493 4:128555317-128555339 TGTGGAGGAAATGACTTGCAAGG - Intergenic
982892615 4:160875264-160875286 TGTGCTTGAAATGCATATAAGGG - Intergenic
984920892 4:184763187-184763209 TGTGGAAGAAATGAATTACATGG - Exonic
985285703 4:188334549-188334571 GATGGATGAAATGAATGGCAAGG - Intergenic
986729840 5:10627294-10627316 TGTGCTTTAACAGAATAGCATGG + Intronic
986986369 5:13504998-13505020 TGTGTTTGAAATGAACAGCATGG + Intergenic
987258769 5:16182633-16182655 TGTAGCAGAAATGAGTAGCAAGG - Intergenic
987665373 5:20931728-20931750 TGTAGTTCCAATGAAAAGCATGG - Intergenic
988411187 5:30887956-30887978 TGTGGTTAAAGTGAAAAGCTTGG - Intergenic
989388270 5:40874530-40874552 TCTGGTTGAAATGCAGAGAATGG - Intergenic
989510821 5:42285816-42285838 TGTTGATGAAATGCATAACATGG + Intergenic
991975124 5:72177605-72177627 TGTGGTTGATTTGAAGAGAATGG - Intronic
992697942 5:79309665-79309687 TGTGGTTAAAATGAAGAGTAAGG - Intronic
993078618 5:83268168-83268190 TGTGATTGGAAGGAACAGCAGGG + Intronic
994729627 5:103476553-103476575 TGTTGTTGAAATCACAAGCATGG - Intergenic
995755990 5:115504667-115504689 GGTAGTTGAAACCAATAGCAGGG + Intergenic
996119834 5:119658727-119658749 TGTCATTAAAATGAAAAGCAGGG - Intergenic
996435942 5:123432262-123432284 TGTGGGTGAAAAGAATATAACGG + Intergenic
997031693 5:130137236-130137258 TTTGGTTGTATTAAATAGCATGG - Intronic
997183240 5:131855073-131855095 CTTGGTTGAAATGAATACCTTGG + Intronic
998556265 5:143127218-143127240 TGTGTTGGAATTTAATAGCAAGG - Intronic
1002177540 5:177409716-177409738 TGGGGGTGAAATGAAGAGCTGGG + Intronic
1002645434 5:180650506-180650528 TGTGAATGAAACGAAAAGCAGGG - Intergenic
1003760944 6:9178101-9178123 GGAGGTTGAAATGAGGAGCAAGG + Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1007746484 6:44046464-44046486 TGTGGTAGAAATGAATGTCATGG - Intergenic
1008586528 6:52955621-52955643 TTTGGTTGAAATGGATGGAATGG - Intergenic
1009846017 6:69135913-69135935 TGTGATTGAAATGAAATCCAAGG + Intronic
1010008543 6:71023916-71023938 TCTGGTTTAAATGAAAAACATGG - Intergenic
1010820135 6:80405818-80405840 TGTGGTGGACATGGAGAGCAAGG - Intergenic
1011023080 6:82836079-82836101 TGTGGCTGAAATGAAGCTCATGG - Intergenic
1012096610 6:94970448-94970470 TGTGGTTTAAATGTATATAAAGG - Intergenic
1013748099 6:113369058-113369080 TGTGGGTAAGATGAATATCAAGG - Intergenic
1014683707 6:124468016-124468038 CTTGGTTGAAGTGAATAACAAGG + Intronic
1016203184 6:141438715-141438737 TTTGCTTGAAATGAAATGCAAGG - Intergenic
1020927076 7:14342788-14342810 TTGGGTTGATATGAATATCATGG - Intronic
1021641859 7:22745393-22745415 TATGGTTGAAATGGATGGAAAGG + Intergenic
1023144036 7:37131377-37131399 TGTAAGTGAAATGAATACCATGG - Intronic
1023719558 7:43078686-43078708 TGTGGTTGAAGTAAATGGGATGG + Intergenic
1023974820 7:45020928-45020950 AGTGTTTGAAATAAATACCAAGG - Intronic
1024385308 7:48744479-48744501 TCTTGGTGAAATGAAAAGCAAGG + Intergenic
1024818739 7:53302531-53302553 TGTGGCTGAAATGATAAGCTTGG - Intergenic
1026608252 7:71834439-71834461 AGTGGTTGAGAGGAACAGCAAGG + Intronic
1027201201 7:76064854-76064876 TGTGGATGCAATGAATGGAAAGG + Exonic
1029998504 7:105033026-105033048 TGTGGTTTAAAAAAATACCAGGG - Intronic
1030253038 7:107469951-107469973 TGTGCTTCATATGTATAGCAGGG - Intronic
1030328192 7:108244486-108244508 TGTGATTGAAAAGCACAGCATGG - Intronic
1030934926 7:115573875-115573897 TCTGGTTGAAAAGAATAGAGCGG + Intergenic
1030963364 7:115955309-115955331 TGTTGTGGAAATGACTAGTATGG + Intronic
1031135627 7:117880675-117880697 TGTGGTTGACATGAAAAACCAGG + Intergenic
1033043739 7:137941631-137941653 TGTGATTGGAATGAATAACCTGG - Intronic
1033046551 7:137967590-137967612 TCAGGTTCAAATCAATAGCAAGG - Intronic
1033237458 7:139649485-139649507 TCTGGTTAAAATGAATATTAAGG + Intronic
1033424019 7:141227007-141227029 TGTTGTTGGAATGACTTGCAGGG + Intronic
1034672476 7:152869113-152869135 TGTGGTTGGAGGGATTAGCAGGG + Intergenic
1037739958 8:21600836-21600858 TCTGGTTGAAAAGAATAACCAGG - Intergenic
1037929425 8:22869026-22869048 TGTGGCTGGAATGAGTAGCGTGG - Intronic
1038900377 8:31835680-31835702 TGTGGTTGAAATGAATAGCAAGG - Intronic
1039582061 8:38675058-38675080 TGTGGTGGAGATGACAAGCAAGG - Intergenic
1041121528 8:54591152-54591174 TGTGGTTGCTATGAGGAGCATGG - Intergenic
1041180922 8:55247137-55247159 TTAGGTTAACATGAATAGCAGGG + Intronic
1045570167 8:103360490-103360512 TGTGGTTGAAATATCTAGCATGG + Intergenic
1046204022 8:110965681-110965703 TATGGTTGATAATAATAGCAGGG + Intergenic
1046504765 8:115123299-115123321 TGTGGGTGAGAAAAATAGCAAGG + Intergenic
1047251411 8:123184190-123184212 TGTGTATCAAATGAAAAGCAGGG - Intronic
1047768413 8:128009751-128009773 AGTGTTTGAGATGACTAGCAGGG + Intergenic
1048227761 8:132605890-132605912 TGTGGCTGCAATGACTAGGAAGG + Intronic
1048924378 8:139258307-139258329 TGTGTCTGAAATGAAAAACATGG - Intergenic
1050419571 9:5449534-5449556 TGCAGTTGAAATGAATAAGAAGG + Intergenic
1051036737 9:12756299-12756321 TGAAGTTGAAGTGAAGAGCAAGG - Intergenic
1052245712 9:26331472-26331494 TGTGGTTGCAAAGAATAATATGG + Intergenic
1052602781 9:30658854-30658876 TGTGATTGCAATGATTAACAAGG - Intergenic
1054852003 9:69856608-69856630 ATGGGTTGAAATGAAGAGCAAGG + Exonic
1056973940 9:91233369-91233391 TGTGGCTGAAGTGCACAGCAGGG + Intronic
1058731112 9:107850762-107850784 TGTTGATGAAATGAGAAGCAGGG + Intergenic
1059922649 9:119175991-119176013 TGTGGTGGGAATGATTAGGAAGG - Intronic
1060446075 9:123689672-123689694 AGTGGTTGAAAAGAATGGCCAGG + Intronic
1060955276 9:127634311-127634333 TGGGTTTGACATCAATAGCATGG + Intronic
1203530210 Un_GL000213v1:135270-135292 TGAAATTCAAATGAATAGCATGG + Intergenic
1203727785 Un_GL000216v2:64330-64352 TGGAGTTGAATTGAATAGAAAGG - Intergenic
1186573805 X:10744180-10744202 TGTGGGTAAAATGAAAAGGAAGG + Intronic
1186904889 X:14100445-14100467 TCTGGTTGAAATGAAAATCCTGG - Intergenic
1186995827 X:15121062-15121084 TCTGGTAGAAATGTATAGGAAGG + Intergenic
1187023098 X:15405190-15405212 TTTGGTTTAAATGAATTGCAGGG - Intronic
1187121743 X:16415363-16415385 TTTGGTCAAAATGAATAGCCTGG + Intergenic
1190909769 X:54759936-54759958 TATGGATGAAATGAAGAGAATGG + Intronic
1192250676 X:69410952-69410974 TGTGGTGGCAAAGAATGGCAAGG - Intergenic
1193696911 X:84719270-84719292 TGTTTTTGAAATGAATCACAGGG - Intergenic
1194578996 X:95648019-95648041 TATGGTTGAAATTACTTGCATGG - Intergenic
1201099475 Y:10660607-10660629 TGTGGTGGAATGGAATAGAATGG - Intergenic
1201121759 Y:10878753-10878775 TGTGGTTGAATGGAATTGAATGG - Intergenic
1201127710 Y:10929616-10929638 TGGGGTTGAAAGGAATGGAATGG - Intergenic
1201199815 Y:11529434-11529456 TGTAGTTGAAACGAATGGAATGG + Intergenic
1201213030 Y:11698015-11698037 TGGAGTTGAAAGGAATAGAATGG + Intergenic
1201214000 Y:11706197-11706219 TGGAGTTGAAAGGAATAGAATGG + Intergenic
1201627749 Y:16033727-16033749 TGTGGCTGAAATGAATGAAAGGG - Intergenic
1201766310 Y:17576426-17576448 TCTGTTTGAAATGAATCACAAGG + Intergenic
1201835242 Y:18329563-18329585 TCTGTTTGAAATGAATCACAAGG - Intergenic
1201850360 Y:18473254-18473276 GGTGGGTCAAAAGAATAGCATGG + Intergenic
1201882958 Y:18847123-18847145 GGTGGGTCAAAAGAATAGCATGG - Intergenic
1202099431 Y:21290994-21291016 TATGGTTGAAAGGTATTGCATGG - Intergenic