ID: 1038901091

View in Genome Browser
Species Human (GRCh38)
Location 8:31844629-31844651
Sequence GTGAGTAAACTGATGCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 16, 3: 90, 4: 601}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038901091_1038901094 11 Left 1038901091 8:31844629-31844651 CCTTTGAGCATCAGTTTACTCAC 0: 1
1: 0
2: 16
3: 90
4: 601
Right 1038901094 8:31844663-31844685 TCAGCTCTACTCATCTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038901091 Original CRISPR GTGAGTAAACTGATGCTCAA AGG (reversed) Intronic
900510885 1:3060582-3060604 ATGGGAAAACTGATGCTCAGAGG - Intergenic
901222751 1:7592942-7592964 AGGAGGAAACTGATGCTCAGAGG + Intronic
901868639 1:12124437-12124459 ATGAGACAACTGAGGCTCAAAGG - Intronic
902050175 1:13557674-13557696 GTGAGGTAACTGAGGCTCAGAGG - Intergenic
902092452 1:13914311-13914333 TTGAGGAAATTGATGCTCAGGGG - Intergenic
902650840 1:17836564-17836586 ATGAGAAAACTGAGGCTCACAGG - Intergenic
902776610 1:18678968-18678990 GTGTGAAAACTGAGGCTCAAAGG - Intronic
902815210 1:18912751-18912773 GTGAGGAAACAGAGGCTCAGAGG + Intronic
902875922 1:19340734-19340756 ATGAGGAAACTGAGGCTCAGAGG + Intronic
902886241 1:19406934-19406956 ATGAGGAAACTGAGGCTCAGTGG + Intronic
903141778 1:21343624-21343646 ATGAGGAAACTGAAACTCAAGGG + Intronic
903165781 1:21519494-21519516 GGGAGAAAACTGAAGCTCAGAGG + Intronic
903278873 1:22238826-22238848 ATGTGTAAACTGAGGCTCAGAGG + Intergenic
903384727 1:22918894-22918916 GTGAGGAAACTGATTCCCAGAGG + Intergenic
903680239 1:25091629-25091651 GTGAGGAAACTGAGGCCCAGAGG + Intergenic
903686858 1:25138238-25138260 ATGAGAAAACTGAGGCTCAGAGG + Intergenic
903739657 1:25551417-25551439 GAGAGGAAACTGAGACTCAAAGG - Intronic
903755580 1:25658210-25658232 GTGAGCAAGCTGAGGCTCAGAGG + Intronic
903761430 1:25701421-25701443 ATGAGGAAACTGAGGCTGAAAGG + Intronic
904014910 1:27412043-27412065 ATGAGTAAACTGAGGCACAGAGG - Intronic
904046333 1:27611266-27611288 GTGAGAAAACTGAGGCTCAGGGG - Intergenic
904279420 1:29408514-29408536 ATGAGGAAACTGAGGCTCAGAGG - Intergenic
904305365 1:29585415-29585437 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
904828880 1:33294276-33294298 ATGAGGAAACTGATGCTCAGTGG + Intronic
905284533 1:36870756-36870778 GTAAGGAAACTGAGGCTCAAGGG - Intronic
905314466 1:37073008-37073030 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
905348831 1:37330472-37330494 GTGAGGAAACTGAAGCTCAGAGG + Intergenic
905453898 1:38074479-38074501 ATGAGGAAACTGAGGCTCATTGG + Intergenic
905758428 1:40532255-40532277 ATGAGTTAACTGAAGCTGAAAGG + Intronic
905875041 1:41427099-41427121 GTGAGGAAACTGAGGCTCCAAGG - Intergenic
906063872 1:42966129-42966151 GAGAGAAAACTGAGGCTCACTGG - Intergenic
906560630 1:46754249-46754271 GTAAGGAAACTGAGACTCAAGGG - Intergenic
906713172 1:47947840-47947862 GTGAGGAAACCGAGGCTCAGAGG + Intronic
906951937 1:50341761-50341783 ATGAGAAAACTGATGCCCAGAGG - Intergenic
907072002 1:51544163-51544185 ATGAAGAAACTGAGGCTCAAAGG + Intergenic
907390473 1:54154886-54154908 GGGAGGAAACTGAAGCTCAAAGG + Intronic
907476157 1:54706962-54706984 ATGAGGAAACTGAGGCTCAGTGG - Intronic
907661149 1:56393516-56393538 GTGAGGAAAGTGATGCTCAGAGG - Intergenic
907731203 1:57067722-57067744 ATGAGTAAACTGAAGCCCAGAGG + Intronic
907775780 1:57513044-57513066 AGGAGAAAACTGAAGCTCAAAGG + Intronic
907786366 1:57616983-57617005 GTGAGAAATCTGATGCCCAGAGG - Intronic
907813920 1:57899863-57899885 CTCAGGAAACTCATGCTCAATGG + Intronic
907912717 1:58841060-58841082 AAGAGGAAACTGATGCTTAATGG + Intergenic
907951822 1:59190565-59190587 GTGAGGAAACTAAGACTCAAAGG - Intergenic
907953121 1:59203072-59203094 GTGAGTAAAGTGAAGTTCAGAGG - Intergenic
908877506 1:68694644-68694666 ATGAGAAAACTGAGGCTCAACGG - Intergenic
909600199 1:77453727-77453749 GTGAGGAAGCTGATGCCCAGAGG - Intronic
909839926 1:80307561-80307583 ATGAGTAAACTGAGGTTCAAAGG + Intergenic
910136344 1:83975420-83975442 ATGAGAAAACTGAGACTCAAAGG + Intronic
910136350 1:83975558-83975580 ATGAGAAAACTGAGACTCAAAGG + Intronic
910427262 1:87130196-87130218 GTGAGGAAACTGAGGCCCAGAGG + Intronic
910795399 1:91092500-91092522 GGGGGGAAACTGAGGCTCAAAGG + Intergenic
911061391 1:93751149-93751171 GTGAGGAAACTGAAGACCAAGGG + Intronic
911167719 1:94739442-94739464 ATGAGAAAACCGATGCTCAGCGG - Intergenic
911979353 1:104546717-104546739 ATGAGGAAACTGAAGCTTAAAGG - Intergenic
912323311 1:108734926-108734948 ATGAGAAAACTGAAGCTCAGAGG + Intronic
913091714 1:115480611-115480633 GTGGGGAAACTGAGGCTCAGAGG - Intergenic
913452703 1:119002829-119002851 GTGAGAAAACTGAGGCTCAAAGG + Intergenic
913508519 1:119541286-119541308 GTGAGGAAACTGAGGCTAAGAGG - Intergenic
914886980 1:151593652-151593674 ATGAGTAAACCGAGGCCCAATGG + Intergenic
915614530 1:157026692-157026714 GTGAGAAAGCTGAGGCTCACGGG - Intronic
915888487 1:159748787-159748809 ATGAGGAAACTGAAGCTCAAGGG + Intergenic
915901706 1:159851442-159851464 ATGAATAAACTGAGGCTCAGAGG - Intronic
916931143 1:169579116-169579138 GCGAGGAAACTGAAGCACAAGGG - Intronic
917007942 1:170436350-170436372 ATGAGAAAACTGAGGCTCAGAGG - Intergenic
917025694 1:170639040-170639062 GAGAGTAAAATGATGCTTATTGG - Intergenic
917616181 1:176746995-176747017 CTGAGGAAACTGAGACTCAAGGG + Intronic
917716479 1:177743161-177743183 GTGAGGAAACTGAAGCAGAAAGG - Intergenic
919469499 1:197960742-197960764 GGGAGTAAGCTGTTGATCAAAGG + Intergenic
919564301 1:199164654-199164676 ATGATAAAACTGAAGCTCAAAGG - Intergenic
920090128 1:203446811-203446833 TTGACTAAACTGCTGCACAAAGG + Intergenic
920113734 1:203604902-203604924 GTGAGGAAACCGAGGCTCAGAGG - Intergenic
920726280 1:208438099-208438121 AAGAGGAAACTGAGGCTCAAAGG - Intergenic
920948336 1:210550419-210550441 TTGAGGAAACTGAAGTTCAAAGG - Intronic
921064724 1:211614629-211614651 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
922972307 1:229752989-229753011 GTGAGTGAAATGATGCTTCAGGG + Intergenic
923351453 1:233111223-233111245 ATGAGAAAACTGAGGCTCAGTGG - Intronic
923520771 1:234733410-234733432 ATGAGGAAACTGAGGCTCAGGGG - Intergenic
923618306 1:235556217-235556239 ATGAGGAAACTGAGGCACAAAGG + Intronic
924031565 1:239890468-239890490 ATGAGGACACTGATGCTCAGAGG - Intronic
924564515 1:245185664-245185686 GTGAATAAACTGGTGGTAAATGG - Intronic
1063503604 10:6576860-6576882 ATGAGGAAACTGAGGCTCAAGGG - Intronic
1064288187 10:14011012-14011034 GTGAAGAAACTGGTGCTCAGAGG + Intronic
1064972416 10:21079429-21079451 GTGAGAAAACTCAGGCTCACAGG + Intronic
1065413534 10:25458672-25458694 ATGAAGAAACTGAGGCTCAAAGG + Intronic
1065528037 10:26642119-26642141 ATGAGCAAACTGAGGCTCAGAGG - Intergenic
1065559192 10:26945367-26945389 ATGAGCAAACTGAGGCTCAGAGG + Intergenic
1065844094 10:29730449-29730471 ATGAGGAAACTGAGGCTCCACGG - Intronic
1065979253 10:30875376-30875398 ATGAGAAAACTGAGGCTCAGGGG + Intronic
1067342335 10:45416221-45416243 GTGAGGAAACTGAGTCTCCAAGG + Intronic
1067346241 10:45441005-45441027 GTGAGGAAACTGAGGCACATGGG - Intronic
1067442716 10:46319364-46319386 GTGAGACCACTTATGCTCAATGG + Intronic
1067561241 10:47306251-47306273 ATGAGAACACTGAGGCTCAAGGG + Intronic
1068098776 10:52525593-52525615 CTGAGGAAACTGAGGCTCAGAGG - Intergenic
1068813648 10:61285334-61285356 ATGAAGAAACTGAAGCTCAAAGG + Intergenic
1069317132 10:67119789-67119811 GGGAGTAAACTCATTCTCTAAGG + Intronic
1069776976 10:70933009-70933031 GTGTGTATTCTGATGCTCAGTGG - Intergenic
1069796882 10:71059337-71059359 GTGAGGAAACTGAGGCCCAGAGG - Intergenic
1069882476 10:71602389-71602411 GTGAGGAAACTGAGGCTCAAAGG + Intronic
1069903972 10:71721493-71721515 ATGAGAAAACTGAGGCTCAAGGG + Intronic
1070569751 10:77631992-77632014 GTGAGGAAACTGAGGCACAAAGG + Intronic
1070615522 10:77966757-77966779 GTGAGGAAACTGAGGCCCAGAGG + Intergenic
1071651431 10:87396470-87396492 GTGATGAAACTGAGGCTCAGGGG - Intergenic
1071793870 10:88985183-88985205 GTGAGAAAACTGATGCTGAGAGG + Intronic
1072090620 10:92123507-92123529 ATAAGTAAACTGAGGCTTAAAGG + Intronic
1072423204 10:95307056-95307078 GTGAGGGAACTGAGACTCAAAGG - Intergenic
1072741014 10:97909419-97909441 ATGAGGAAACTGAGGCTCAAGGG - Intronic
1073187081 10:101621714-101621736 ATGAGGAAACTGAAGCTCAGAGG + Intronic
1073459000 10:103654784-103654806 GTAAGGAAACTGATGCTGAGAGG + Intronic
1073967783 10:109011440-109011462 GTAAGGAAACTGATACTCAAAGG + Intergenic
1074753491 10:116608540-116608562 GAGAGGAAACTGAGGCACAAAGG - Intronic
1074876897 10:117620739-117620761 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1075256524 10:120929967-120929989 GTGAGTAAACTGAGGCACAGAGG - Intergenic
1075711451 10:124532983-124533005 ATGAGAAAACTGAGGCTCAGTGG - Intronic
1076074400 10:127521918-127521940 ATGAGGAAGCTGAGGCTCAAAGG - Intergenic
1077314008 11:1908058-1908080 GAGAGCAAACTGAAGCTCAGAGG - Intergenic
1077317584 11:1926228-1926250 GTGGGGAAACTGAGGCTCAGAGG - Intronic
1077737845 11:4810022-4810044 GTGAGAAAACTAATACTTAAAGG - Intronic
1078261964 11:9717946-9717968 GTCAGAAAACTGATGCTGACTGG - Intronic
1078564799 11:12405037-12405059 ATGAGGAAACTGAGGCTAAAAGG - Intronic
1079244043 11:18740424-18740446 ATGAGGAAACTGAAGCTCAGAGG + Intronic
1079336652 11:19576011-19576033 GTGAGGAATCTGAGGCTCAAAGG + Intronic
1079523194 11:21353368-21353390 GTGAGGAAACTGAGGCACAGAGG + Intronic
1080651299 11:34224637-34224659 ACGAGCAAACTGAGGCTCAAAGG - Intronic
1080746715 11:35114970-35114992 ATGAGTAAACTGAGGCTCAGGGG + Intergenic
1081529532 11:43948388-43948410 GTGAGAAAACTGAAGCTCAGAGG + Intergenic
1081572740 11:44301784-44301806 ATGAGCAAACTGAGGCCCAAGGG - Intronic
1081592031 11:44430240-44430262 GAGAGGAAACTGATTCTCAGAGG + Intergenic
1081648603 11:44807769-44807791 ATGAGGAAACTGATGTCCAAAGG - Intronic
1081694074 11:45097493-45097515 GTGAGGAAATTGAAGCTCAGGGG + Intronic
1081813312 11:45925082-45925104 ATGAGAAAACTGAGGCTCAGAGG - Intronic
1081962515 11:47148809-47148831 ATGAGGAAACTGAGGCTCAGAGG + Intronic
1083188995 11:61036027-61036049 AGGAGGAAACTGATGCTCACAGG + Intergenic
1083628303 11:64083071-64083093 GTGAGGAAACTGAGGCTCAGGGG + Intronic
1083639544 11:64138086-64138108 GTGAGGAAACTGAGGTTCAGGGG + Intronic
1083793269 11:64999651-64999673 GTGAGGAAACTAATGCCCAGAGG + Intergenic
1083965166 11:66039343-66039365 GTGAGGAAAGTGAGGCTCAAAGG + Intergenic
1084175233 11:67419385-67419407 GTGAGTAAACTGAGGCAAAAGGG - Intronic
1084561168 11:69906221-69906243 GTGAGGAAACTGAGGCTCAGAGG - Intergenic
1084907692 11:72360857-72360879 ATGAGGAAACTGAGGCTCAGAGG + Intronic
1085198183 11:74684614-74684636 GTGAGGAAACTGAGGCCCATTGG - Intergenic
1085228138 11:74941204-74941226 GTGAGGAAACTGAAGTTCAGAGG - Intronic
1085414518 11:76311279-76311301 GTGGGGAAACTGAGGCTCACAGG - Intergenic
1085896583 11:80647359-80647381 GTGAGTTATTTGAAGCTCAATGG - Intergenic
1086254134 11:84854327-84854349 ATGAGGAAACTGATGCTCAGAGG - Intronic
1086474783 11:87160850-87160872 GTGAGTCAATTAATGCACAAAGG - Intronic
1087054357 11:93919111-93919133 ATGAGGAAACTGATGCTCCAAGG + Intergenic
1087239392 11:95757903-95757925 ATGAGGAAACTGAAGCTCAGAGG + Intergenic
1088455261 11:110026774-110026796 ATGAGACAACTGGTGCTCAAAGG - Intergenic
1088693484 11:112347107-112347129 GTGAGGAAACTGAGACTCCAAGG + Intergenic
1088910596 11:114188280-114188302 ATGAGGAAACTGAGGCTGAAAGG + Intronic
1089112398 11:116067183-116067205 GTGACAAAACTGAGGCTCAGAGG - Intergenic
1089167696 11:116489709-116489731 TTGAGGAAACTGATGCCCAGAGG - Intergenic
1089544731 11:119214771-119214793 GTTAATAAACTGAAGCTAAAAGG - Intronic
1089616662 11:119698652-119698674 ATGAGGAAACTGAGGCTCACAGG - Intronic
1089631397 11:119786787-119786809 ATGAGAAAAATGAGGCTCAAGGG - Intergenic
1089892070 11:121891555-121891577 ATGAGGAAACTGAAGCTCAGAGG + Intergenic
1090437322 11:126697513-126697535 GTGACACAACTGATGCTCAGTGG + Intronic
1090529949 11:127580117-127580139 ATGAGAAAACTGAAGCTCAGAGG - Intergenic
1090619415 11:128548394-128548416 ATGAGGAAACTGAGGCTCAGAGG + Intronic
1090924386 11:131236663-131236685 ATGAGAAAACTGAGGCTCATGGG + Intergenic
1090963411 11:131577122-131577144 ATGAGGAAACTGATGCTAAAAGG - Intronic
1091028864 11:132165619-132165641 GTGAGGAAACTGAGGCTCAGGGG + Intronic
1092015900 12:5157720-5157742 CTGAGAAAACTGAGGCTCAGTGG - Intergenic
1092114103 12:5986262-5986284 GTGAGGAAACTGAGGCACAGCGG - Intronic
1092152901 12:6263273-6263295 ATGAGGAAACTGAGGCTCCAAGG - Intergenic
1092280679 12:7095760-7095782 ATGAGGAAACTGAGGCTCAGGGG - Exonic
1093543093 12:20310982-20311004 GTGAGCAGAATGATGCTGAAAGG - Intergenic
1094027381 12:25973429-25973451 ATGAGCAAACTGAGGATCAAAGG - Intronic
1095673892 12:44893283-44893305 GAGAGAAAACTGAGGCTCAAAGG - Intronic
1095828024 12:46550624-46550646 GTGAACAAATTGATGCTCCAAGG - Intergenic
1096232017 12:49902102-49902124 ATGAGGAAACTGAGGCTCAAAGG + Intronic
1096762018 12:53849677-53849699 TTGAGGAAACTGAAGCTCAAGGG - Intergenic
1097168822 12:57100877-57100899 ATGAGGAATCTGATGCTCAGAGG - Intronic
1097373279 12:58810069-58810091 ATGAGGAAACTGAACCTCAAAGG + Intronic
1097534639 12:60851820-60851842 GTGAGCAAACTGAGGCCCAAAGG - Intergenic
1097631158 12:62064082-62064104 ATGAGAAAACTGAGGCTCAGGGG + Intronic
1098797185 12:74904668-74904690 GTGAGTTAACTGATGGCCATAGG - Intergenic
1100418473 12:94404431-94404453 GGGAGAAAAGTGATTCTCAAAGG + Intronic
1101090013 12:101275640-101275662 ATGAGGAAACTGAGGCTGAAAGG + Intergenic
1101095644 12:101337096-101337118 GTGATGAAACTGAGGCTCAGAGG - Intronic
1101272728 12:103164836-103164858 GTGAGTATACTGATACACATGGG - Intronic
1101446010 12:104737388-104737410 ATGAGTCAACTGAGGCTCAGAGG - Intronic
1101727943 12:107403473-107403495 AAGAGTAAACTGAGGCTCACAGG - Intronic
1101771651 12:107757465-107757487 CTTAGTAAACTGTTGCTGAATGG - Intronic
1101906991 12:108834412-108834434 GTGAGGACACTGAGGCTTAAGGG + Intronic
1101966865 12:109287755-109287777 GTGAGTAAACTGAGGCTCAGAGG + Intronic
1102048582 12:109845731-109845753 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1102171782 12:110847973-110847995 GTGAATAGACTGAGGCCCAAGGG + Intronic
1102178833 12:110896455-110896477 GTGAGAAAACTGAGGCTCTGAGG - Intronic
1102240742 12:111323044-111323066 GTGAGGAAACGGAGGCTCAGAGG + Intronic
1102247341 12:111363564-111363586 ATGAGGAAACTGACGCTCATAGG + Intronic
1102440747 12:112962488-112962510 GTGGGTAAACTGAGGTTCAGAGG - Intronic
1102455206 12:113066599-113066621 GTGAGGAAACAGAGGCTCAGAGG - Intronic
1102649732 12:114431099-114431121 GTGGGTAAACTGAGGCTCAAAGG + Intergenic
1103001801 12:117390479-117390501 ATGAGAAAACTGAGGCTGAAAGG + Intronic
1103159186 12:118713387-118713409 ATGGGTAAACTGAGGCTCAGAGG + Intergenic
1104048085 12:125177522-125177544 ATGAGAAAACTGAGGCTCTAGGG - Intergenic
1104944321 12:132408918-132408940 GTGAGGAAACTGAGGCACACAGG - Intergenic
1107124298 13:36829686-36829708 GTAAATAAACTCAAGCTCAATGG - Intergenic
1107678515 13:42821628-42821650 ATGAGTAAACTGAACCTCACAGG + Intergenic
1107992147 13:45828082-45828104 GTGAGAAAACTGAGGTTCAGAGG - Intronic
1108231291 13:48344660-48344682 GTAAGTAAACTGAGGATGAATGG + Intronic
1108575375 13:51785886-51785908 ATGAGGAAACTGAGGCTCAGAGG - Intronic
1109661795 13:65469290-65469312 GTGAGTAAAATGAGACTTAAAGG - Intergenic
1110905283 13:80879674-80879696 ATGAGGTAACTGAAGCTCAATGG - Intergenic
1111303612 13:86376848-86376870 GAGAGTAGAATGATGCTTAACGG + Intergenic
1111900971 13:94199454-94199476 ATGAGGAAACTGAAGCTCATAGG - Intronic
1112184291 13:97113250-97113272 GTGGGGAAACTGAGGCTCACAGG - Intergenic
1112364057 13:98741948-98741970 GTGGGGAAACTGGTGCTGAAGGG + Intronic
1112961010 13:105126248-105126270 CTAAGGAAACTGAGGCTCAAAGG - Intergenic
1113495697 13:110726851-110726873 GTGAGGAAACCGAGGCCCAAGGG + Intergenic
1114477782 14:23009994-23010016 GTGAGGAAACTGTTGCTAAGGGG - Intronic
1114867000 14:26608051-26608073 GTGAATAAACTGAGCCACAAAGG - Intergenic
1115448013 14:33514083-33514105 GTGAGTGAACTCATGTCCAAGGG - Intronic
1115650693 14:35401040-35401062 ATGAGAAAACTGAGGCTCAGAGG + Intergenic
1117661735 14:58013687-58013709 ATGAGGAAACTGGGGCTCAAGGG + Intronic
1118838441 14:69493450-69493472 GTGAGGAAACTGAGGCACAGAGG - Intronic
1119112662 14:71989554-71989576 ATGAGGAAACTGAAGCTCAGGGG + Intronic
1119643518 14:76331343-76331365 ATGAGGAAACTGAGGCACAAAGG - Intronic
1119760968 14:77151653-77151675 ATGAGAAAACTGAAACTCAAAGG + Intronic
1119873179 14:78034237-78034259 GTGCCTAAACTGAAGCTCAATGG - Intergenic
1120178090 14:81316626-81316648 GTGAGGAAACTGAAGTACAAAGG - Intronic
1120824501 14:88943172-88943194 TTGAGGAAACTGAGGCTCAGTGG + Intergenic
1120951618 14:90046830-90046852 ATGAGGAAACTGAGGTTCAAGGG + Intergenic
1120956321 14:90086344-90086366 GTGAGAAAACTGAAGCACAGAGG + Intronic
1121434046 14:93907096-93907118 GTGAGGAAACTGAGGCTGAGAGG - Intergenic
1121712286 14:96047646-96047668 GTGAGGAAACTGAGGCTTAGAGG + Intronic
1122004466 14:98690648-98690670 ATGAGTAAACTGAGGCTCAAAGG + Intergenic
1122097750 14:99383922-99383944 ATGAGTAAGCTGAGGCCCAACGG - Intergenic
1122254913 14:100469443-100469465 GAGAGGAAACTGAGGCTCAGAGG + Intronic
1123630139 15:22255508-22255530 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1124437314 15:29661779-29661801 GTGTGAAAACTGTTGCCCAATGG + Intergenic
1124686143 15:31783733-31783755 GTGAGGAAAATGATGTTCCATGG - Intronic
1126938670 15:53740828-53740850 ATGAGGAAACTGAGGCTCAGAGG - Intronic
1127109583 15:55653411-55653433 GGTAGGAAACTGATTCTCAAAGG - Intronic
1127378189 15:58404291-58404313 ATGAGTAAACTGATGCTCACTGG + Intronic
1128285202 15:66430648-66430670 ATGAGAAAACTGAGGCCCAAAGG - Intronic
1128496858 15:68203735-68203757 GTGAGAAAACCGAGGCTCAAGGG + Intronic
1128672836 15:69587124-69587146 GTGAGGAAACTGAGCCCCAAGGG + Intergenic
1128683948 15:69670184-69670206 GTGAGGAAACTGAGGTTCAGAGG + Intergenic
1128708686 15:69856186-69856208 ATGGGGAAACTGAGGCTCAAAGG - Intergenic
1128742325 15:70092509-70092531 GTGAGGAAACTGAGGCTTCAGGG - Intronic
1128826540 15:70723084-70723106 ATGAGGAAACTGACGCTCAGGGG - Intronic
1128885952 15:71288442-71288464 ATGGGGAAACTGATGCTCAGAGG + Intronic
1129111453 15:73339630-73339652 GTGGGGAAACTGAGGCCCAAAGG + Intronic
1129940581 15:79493670-79493692 ATGAGTAAACTGAGGTTCAGTGG - Intergenic
1131317791 15:91355748-91355770 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1131441565 15:92463578-92463600 GTCAGCAAACTGCTGCTCAAGGG + Intronic
1131812486 15:96186870-96186892 ATGAGGAAACTGAGGTTCAAAGG + Intergenic
1131936934 15:97516864-97516886 AGGAGTAAACTGAAGCTCAGAGG + Intergenic
1132023848 15:98387919-98387941 CTGAGGAAACTGAAGCTCAGGGG - Intergenic
1132259384 15:100408906-100408928 GAGAGGAAACTGAGGCTCAGGGG + Intronic
1133300487 16:4779496-4779518 GTGAGGAAACTGAGGCCCAGAGG + Intronic
1133861310 16:9597899-9597921 GTAGGTAAACTGAAGCTCCAAGG - Intergenic
1134244158 16:12527617-12527639 TTGAGGAAAGTGAGGCTCAAAGG + Intronic
1134584524 16:15398369-15398391 ATGAGGAAACTGAGTCTCAAAGG + Intronic
1134684122 16:16146868-16146890 GTGAGGAAACTGAGGCTCAAGGG - Intergenic
1134684813 16:16150990-16151012 GTGGGGAAACTGAGGCACAAAGG - Intronic
1134745593 16:16585623-16585645 GCGAGATAACTGAAGCTCAAAGG - Intergenic
1134890273 16:17835413-17835435 ATGAGTAAACTGAGGCACAGAGG + Intergenic
1135044009 16:19139907-19139929 GTGAATAAACTGAGGTTCAGAGG - Intronic
1135055069 16:19225100-19225122 ATGAGGAAACTGAAGCTCAGAGG - Intronic
1135718416 16:24793175-24793197 GGAATTAAACTGATGCTCAAAGG + Intronic
1136339137 16:29630496-29630518 GTGAGGAAGCTGAGGCTCAGAGG + Intergenic
1136371798 16:29841384-29841406 ATGAGGAAACTGAAGCCCAAGGG + Intronic
1136624749 16:31455459-31455481 GTGAGGAAACTGAGGCTTAAAGG + Intergenic
1136657313 16:31717702-31717724 ATGAGAAAAATGATGCACAATGG - Intronic
1137568141 16:49546944-49546966 GTGAGAAAACTGAGGCTCAGAGG - Intronic
1137612986 16:49831470-49831492 GTGAGGAAACTGAGGCTCTGCGG - Intronic
1137704126 16:50522257-50522279 ATGAGGAAACTGAGGCTCCAAGG + Intergenic
1138117457 16:54371805-54371827 ATGAGAAAACTGAGGCTCAAAGG - Intergenic
1138477590 16:57281278-57281300 GTGAGAAAACTGAGGCTCAGAGG - Intronic
1139765799 16:69228850-69228872 ATGAGAAAACTGAGGCTCAGAGG + Intronic
1140265384 16:73416170-73416192 GAGAGAAAACAGAAGCTCAAAGG + Intergenic
1140861562 16:79022898-79022920 CTGAGTAAACTGATGCTCAGGGG - Intronic
1140872137 16:79116318-79116340 GTGAGTAAAATGATGTCAAACGG - Intronic
1141180932 16:81752930-81752952 ATGAGGAAACTGAGGCCCAAAGG - Intronic
1141190066 16:81818184-81818206 GTGAGGAAACTGAGGCACAGAGG - Intronic
1141596223 16:85098457-85098479 ATGAGGAAACTGAGGCTCAGAGG + Exonic
1141972953 16:87495151-87495173 ATGAGGAAACTGAGGCTCAGAGG - Intergenic
1143256285 17:5560386-5560408 ATGAGAAAACTGAGGCTCATAGG - Intronic
1143388648 17:6547139-6547161 ATGAGAAAACTGAAGCTCAGAGG + Intronic
1144025006 17:11269782-11269804 GTGAGGAAACTGAGGCACACAGG + Intronic
1144958473 17:19031662-19031684 ATGAGGAAACTGAGGCTCAGAGG + Intronic
1144976686 17:19142862-19142884 ATGAGGAAACTGAGGCTCAGAGG - Intronic
1145227701 17:21144299-21144321 GTGAGAAAACTGGGGCCCAAAGG + Intronic
1146675006 17:34767384-34767406 CTGAGCAAACTGAGGCTCAGAGG - Intergenic
1146837432 17:36123498-36123520 ATGAAGAAACTGAAGCTCAAAGG - Intergenic
1147050838 17:37793769-37793791 GTGAGTAAATTGAGGCACAAAGG + Intergenic
1147308605 17:39580210-39580232 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1147328951 17:39685096-39685118 CAGAGTAAGCTGAGGCTCAAAGG - Intronic
1147367936 17:39971584-39971606 GTGAGACAGCTGATGGTCAAAGG + Exonic
1147467335 17:40620289-40620311 GTCAGGAAACTGATGCTTATTGG + Intergenic
1147588185 17:41665145-41665167 CTGAGTTAACTGAGGCTCAGAGG + Intergenic
1148049446 17:44762155-44762177 ATGAGCAAACTGAGGCTCAGAGG + Intronic
1148496806 17:48057896-48057918 GTGAGGAAATTGAAGCTCAGAGG + Intronic
1148799003 17:50211263-50211285 TTGAGGAAACTGAGGCTCATTGG - Intergenic
1148905381 17:50908699-50908721 ATGAGGAAACTCAGGCTCAAAGG + Intergenic
1149297405 17:55273214-55273236 ACGAGTAAACTGAGGCTTAAAGG - Intronic
1149527094 17:57365211-57365233 ATGAGAAAACTGAGGCACAATGG + Intronic
1149768909 17:59304465-59304487 GTCAATAAAGTGAGGCTCAAAGG + Intergenic
1149917400 17:60623129-60623151 ATGAGTAAACAGATGCTAAGTGG + Intronic
1150132497 17:62676725-62676747 ATGAGAAAACTGAGGCTCAGAGG - Intronic
1150150353 17:62803937-62803959 GTGAGGAAACTGAGGACCAAAGG + Intronic
1150479372 17:65497586-65497608 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1150715672 17:67570670-67570692 ATGAGGAAACTGAAGCTCAGAGG + Intronic
1151672664 17:75580235-75580257 GTTAGGAAACTGAAGCTCAGAGG + Intergenic
1152101667 17:78305145-78305167 ATGAGGAAACTGAGGCTCCACGG - Intergenic
1153223664 18:2882120-2882142 GTGAGAAAACAGAGGCTCATGGG - Intronic
1154058026 18:11030455-11030477 ATGAGAAAACTGAGGCCCAAAGG + Intronic
1154486694 18:14877635-14877657 ATGAGAAAACTGAGGCTCAGAGG + Intergenic
1156647814 18:39187692-39187714 GGGAGGAAACTGAAGCTTAAAGG - Intergenic
1156828993 18:41468023-41468045 GTGAGCAAACTTTGGCTCAATGG - Intergenic
1157291914 18:46415713-46415735 ATGAAGAAACTGAGGCTCAAGGG - Intronic
1157446846 18:47752771-47752793 GTGAGGAAACTGAAGCACAGAGG + Intergenic
1157473097 18:48004614-48004636 GTGAGGAAACTGAGACTCAGGGG + Intergenic
1160946883 19:1647837-1647859 AAGAGGAAACTGATGCTCCAAGG - Intronic
1161048691 19:2150906-2150928 GAGAGTAAACTGAGGGTCCAGGG + Intronic
1161280105 19:3441418-3441440 GTGGGGAAACTGAGGCCCAAAGG + Intronic
1161320665 19:3639354-3639376 ATGAGGAAACTGAGGCTCAGAGG - Intronic
1161626611 19:5330659-5330681 ATGAGAAAACTGAGGCTCAGGGG + Intronic
1162536110 19:11263490-11263512 ATGAGTAAACTGAGGCACAGAGG + Intergenic
1162768439 19:12934328-12934350 GTGAGAAAACTGAGGCTCAGAGG + Intergenic
1163328455 19:16620332-16620354 GTGAGGAAACTGAGGCTCAGCGG - Intronic
1163445564 19:17344253-17344275 ATGAGAAAACTGAGGCTCACAGG + Intergenic
1163505774 19:17705286-17705308 ATGAGGAAACTGAGGCACAAAGG + Intergenic
1163538225 19:17890720-17890742 ATGAGGAAACTGAGGCTCAGAGG + Intronic
1163561837 19:18023790-18023812 ATGAGGAAACTGAGGCTCAGAGG - Intergenic
1163771418 19:19193299-19193321 TGGAGGAAACTGAGGCTCAAAGG + Intronic
1163827753 19:19533104-19533126 GTGGGGAAACTGAAGCTCAGAGG + Intronic
1165112816 19:33512219-33512241 ATGAGAAAACTGAGGCTCAGAGG - Intronic
1165485308 19:36091958-36091980 GGGAGCAAACTGAGGCTCAGGGG - Intronic
1165838051 19:38771210-38771232 GTGAGGAAACTGAGGCCCAGAGG - Intronic
1165841514 19:38791487-38791509 GTGAGGAAACTGAGGCCCAGAGG + Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1166963480 19:46513874-46513896 ATGAGGAAACTGAGGCTCAGAGG - Intronic
1167248088 19:48385874-48385896 ATGAGGAAACTGAGGCCCAAAGG + Intronic
1167850650 19:52198781-52198803 GTGAGGACACTGATGCACAGAGG - Intronic
1168165852 19:54547123-54547145 CAGAGTCAACTGATGCTAAAGGG + Intergenic
1168683857 19:58336136-58336158 ATGAGTAAACTGAGGCACAAGGG - Intronic
925307011 2:2855246-2855268 ATGAGGAAACTGAAGCTCAGAGG - Intergenic
926086618 2:10024021-10024043 ATGAGGAAACTGAGGCCCAAGGG - Intergenic
926334257 2:11851390-11851412 ATGAGGAAACTGAGGCTCAAGGG + Intergenic
926352834 2:12012431-12012453 ATGAGGAAACTGAGTCTCAAAGG - Intergenic
926353713 2:12020813-12020835 ATGAGGAAACTGAGGCACAAAGG - Intergenic
926725400 2:15993663-15993685 GTGAGGAAATTGATGCACAGTGG - Intergenic
927381268 2:22481811-22481833 GTGAGGAAACTGAGGCTCAAGGG + Intergenic
927512512 2:23653206-23653228 GTGGGGAAACTGAGGCTCAGAGG + Intronic
928200014 2:29241824-29241846 ATGAGGAAACTGAGGCTCAGAGG + Intronic
928445291 2:31328773-31328795 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
928600894 2:32902366-32902388 ATGAGGAAACTGAAGCTCAGAGG + Intergenic
929312010 2:40436251-40436273 ATGAGTAAAGTAATGCTCACAGG + Intronic
929585482 2:43111450-43111472 ATGAGTAAACTGACACTCAGAGG + Intergenic
929742715 2:44620869-44620891 ATGAGAAAACTGAAGCACAAAGG - Intronic
930006201 2:46899020-46899042 ATGAGGAAACTGAGGCACAAAGG + Intergenic
930064531 2:47317560-47317582 ATGAGGAAACTGAAGCTCAAAGG - Intergenic
930714240 2:54577668-54577690 ATGAGGAAACTGAGGCACAAAGG + Intronic
931230984 2:60374678-60374700 GTGAGTAAACTGAGGCACGGTGG + Intergenic
931444928 2:62318820-62318842 CTGAGGAAACTGAGGCTCAGAGG + Intergenic
932192280 2:69751098-69751120 ATGAGGAAACTGAGGCACAAAGG + Intronic
932271301 2:70412504-70412526 GTGACAAAACTGAGGCCCAAAGG - Intergenic
932585264 2:73023664-73023686 ATGAGGAAACTGAGGCTCAGAGG - Intronic
932842976 2:75101480-75101502 TTGAGGAAACTGAGGCTCAGAGG + Intronic
935082445 2:99811390-99811412 ATGAGTAAACTGAGGCACAGAGG + Intronic
935974665 2:108566438-108566460 ATGAGGAAACTGATTCTCAGAGG + Intronic
936053063 2:109240177-109240199 GTGAGAAAACTGAGGCCCAGAGG - Intronic
936269451 2:111037678-111037700 CTGAGGAAACTGAGGCTCAGAGG + Intronic
937086789 2:119177229-119177251 GTGAGAAAACTGAGGCTCACAGG - Intergenic
937472477 2:122186105-122186127 GTGAGGAAACTGCAGCTGAAAGG - Intergenic
937529024 2:122806527-122806549 GTAAGAAAACTGATGCTCTGAGG - Intergenic
938758691 2:134403879-134403901 CTGAGCAAAATGATCCTCAAGGG - Intronic
940723883 2:157312642-157312664 GTAAGAAAACTGATGCTGAGAGG + Exonic
941373386 2:164696076-164696098 CTGAGCAAACTGAGGCTCAAAGG - Intronic
941417574 2:165241203-165241225 TTCAGTATACTGTTGCTCAATGG + Intronic
941642797 2:168007471-168007493 CTTAAAAAACTGATGCTCAAGGG + Intronic
941849782 2:170168184-170168206 GTGACAAAACTGAGGCTCAGGGG + Intergenic
941854447 2:170216424-170216446 ATGAAAAAACTGAGGCTCAAAGG + Intronic
941923354 2:170873112-170873134 GAGAGTTAACTGGTGCTCAGTGG + Intergenic
942151381 2:173078941-173078963 GTGAGAAAACTGAGGATCAGGGG - Intronic
943727215 2:191264917-191264939 GTGAGGAAACTGAGGCTTGAAGG + Intronic
945037392 2:205715788-205715810 ATGAAGAAATTGATGCTCAAAGG + Intronic
945135441 2:206622724-206622746 GGGAGGAAACTGAGGCTGAATGG - Intergenic
945185423 2:207134816-207134838 GTGAGGAAACTGAGGCACAGAGG - Intronic
945767085 2:213994392-213994414 GTGAGATAACAGATTCTCAAAGG + Intronic
946032575 2:216716773-216716795 ATGAGGAAACTGAGGCTAAAGGG - Intergenic
946418782 2:219553371-219553393 ATCAGGAAACTGATGCTCAGTGG - Intronic
946795394 2:223345759-223345781 GTGTGGAAACTCAGGCTCAATGG + Intergenic
947754433 2:232551141-232551163 ATGAGAAAACTGAGGCTCAGAGG - Intronic
948870086 2:240793341-240793363 GTGGGGAAACTGAGGCCCAAAGG + Intronic
1170683435 20:18547250-18547272 GTGAGGAAACTGAGGCACAGAGG - Intronic
1170779920 20:19416041-19416063 ATGAGAAAACTGAGGCTCAGTGG - Intronic
1171255701 20:23687805-23687827 ATGGGTAAACTGATACTCGAGGG - Intronic
1172066438 20:32223933-32223955 GTGAGGAAACTGAGGCACAGAGG - Intronic
1172333353 20:34092223-34092245 GCCAGTAAACTTATGGTCAATGG - Intronic
1172778802 20:37423570-37423592 AGGAGGAAACTGACGCTCAAGGG - Intergenic
1172886077 20:38231669-38231691 ATGAGGAAACTGAAGCTCAGAGG - Intronic
1173415949 20:42856067-42856089 GTGAGCAAACTGAAGCTTTAGGG + Intronic
1173813156 20:45968508-45968530 GGGAGTCAACTGAGGCTCAGGGG - Intronic
1173970433 20:47148237-47148259 ATGAGCAAACTGAGGCTCAGAGG - Intronic
1174050014 20:47760992-47761014 ATGAGGAAACTGAGGCACAAAGG - Intronic
1174059946 20:47825813-47825835 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1174071925 20:47905457-47905479 ATGAGGAAACTGAGGCTCAGAGG - Intergenic
1174108862 20:48183863-48183885 GTGAGGAAACTGAGTCACAAAGG + Intergenic
1174152123 20:48493212-48493234 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1174176927 20:48651188-48651210 GGGAGTAAACTGAGGCTAAAGGG + Intronic
1174932348 20:54829628-54829650 ATGAGGAAACTGAAGTTCAAAGG - Intergenic
1175226095 20:57444835-57444857 ATGAGGAAACTGAGGCTCAAGGG + Intergenic
1175289891 20:57868622-57868644 ATGAGCAAACTGAGGCTCAGCGG - Intergenic
1175537857 20:59727630-59727652 GTGAGAAAAGTGAGGCTCAGAGG - Intronic
1176794608 21:13361764-13361786 ATGAGAAAACTGAGGCTCAGAGG - Intergenic
1177355825 21:20005440-20005462 ATGAGAAAACTTAAGCTCAAAGG - Intergenic
1179207553 21:39296675-39296697 GTGAGGTAACTGAGGCTCAAAGG + Intronic
1179333975 21:40432810-40432832 GTGAGGAAACTGAGGCCCAGAGG + Intronic
1179382639 21:40913618-40913640 ATGAGGAAACTGAGGCACAAAGG - Intergenic
1180956327 22:19743012-19743034 GTGGGGAAACTGAGGCCCAAAGG - Intergenic
1181671939 22:24429698-24429720 ATGAGGAAACTGAGGCCCAAAGG - Intronic
1181885641 22:26020122-26020144 ATGAGGAAACTGAGGCTCAGTGG - Intronic
1181894807 22:26097914-26097936 ATGAGAACACTGAGGCTCAATGG + Intergenic
1181922322 22:26330036-26330058 ATGAGGAAACTGAGGCTCAGAGG - Intronic
1181963368 22:26639011-26639033 GCGAGGAAACTGAGGCTCAGTGG - Intergenic
1182051186 22:27314046-27314068 ATGGGTAAACTGAGGCTCAGAGG - Intergenic
1182118583 22:27772695-27772717 GTGAGGAAACTGAGGCCCAAAGG - Intronic
1182786335 22:32910896-32910918 GTGAGGAAGCTGAGGCTCAGAGG + Intronic
1183139582 22:35924076-35924098 GTGAGGAAACCAAGGCTCAAAGG - Intronic
1183176113 22:36225866-36225888 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1183214652 22:36471633-36471655 ATGAGAATACTGAGGCTCAAAGG + Intronic
1183288455 22:36982626-36982648 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1183293398 22:37016503-37016525 ATGAGGAAACTGAGGCTCAGAGG - Intronic
1183355504 22:37356734-37356756 GTGAGGAAACTGAGGCACAGAGG + Intergenic
1183388567 22:37529660-37529682 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1183711094 22:39503919-39503941 GTGAGGAAGCTGGTGCTCAGCGG + Intronic
1183771522 22:39930388-39930410 ATGAGGAAAGTGAAGCTCAAAGG - Intronic
1184387373 22:44183755-44183777 ATGAGGAAACTGAGGCACAAGGG + Intronic
1184410703 22:44324620-44324642 GTAAGGAAACTGAGGCTCCAGGG + Intergenic
1184488212 22:44794105-44794127 GTGAGAAAACTGAGGCCCAGAGG - Intronic
949536294 3:4998470-4998492 TTGAGGAAACTGAGGCTCAGAGG + Intergenic
949840361 3:8313375-8313397 ATGGGTAAACTGAGGCTCAGAGG - Intergenic
949909458 3:8889312-8889334 GTGAGGAAACTGAGGCTCAAAGG - Intronic
949931427 3:9081421-9081443 GTGAGGTAGCTGAGGCTCAAAGG - Intronic
949982605 3:9511404-9511426 ATGAGGAAACTGAGGCTCAGAGG + Intronic
950073837 3:10173153-10173175 ATGAGGAAACTGAGGCTCAGGGG + Intronic
950236119 3:11321698-11321720 CTGAGGAAACTGAGGCTCAGAGG - Intronic
950505404 3:13391450-13391472 GAGAGGAAACTGAGGCTGAAAGG + Intronic
950565799 3:13768830-13768852 AAGAGGAAACTGAGGCTCAAAGG - Intergenic
950659422 3:14457667-14457689 ATGAGGAAACTGAGGCTCAGGGG + Intronic
950686341 3:14621254-14621276 ATGAGAAAACTGAGGCACAAGGG + Intergenic
950778662 3:15372634-15372656 GTGAGTAAGCTCATGCTCATGGG - Intergenic
951276569 3:20694288-20694310 ATGAGGAAACTGAGTCTCAAAGG - Intergenic
952073517 3:29668886-29668908 GTGTGGAAACTGATGTTGAAAGG + Intronic
952223647 3:31351277-31351299 GTGAGAAAACTGAAGCATAAAGG - Intergenic
952338061 3:32421952-32421974 ATGAGGAAACTGAGGCCCAACGG + Intronic
952760445 3:36908840-36908862 ATGAGGAAACTGAGGCTCAGAGG + Intronic
953118305 3:40014573-40014595 GTGAGGAAACTGAGGCACAGTGG - Intronic
953383682 3:42492763-42492785 GTGAGTCTAGTGCTGCTCAAGGG - Intronic
953637706 3:44676752-44676774 GTGTGGAAAATGATGCTCAGTGG - Intergenic
953698236 3:45176503-45176525 ATGAGAAAACTGAAGCTCAGAGG - Intergenic
954263516 3:49456730-49456752 ATGAGAAAACTGAGGCCCAAAGG - Intergenic
954323051 3:49844937-49844959 GTGAGTCAGCTGATGCCCAGAGG - Intronic
954708671 3:52494344-52494366 GTGGGGAAACTGAGGCTCAGAGG - Intergenic
954751464 3:52816578-52816600 GTGAAGAAACTGAGGCTCAGAGG + Intronic
954784112 3:53080752-53080774 ATGAGTAAACTGAGGCACAGGGG + Intronic
955405555 3:58623558-58623580 CTGAGGAAACTGAGGCTCAGAGG + Intronic
955457069 3:59134779-59134801 ATGAAGAAACTGAGGCTCAAGGG + Intergenic
955619399 3:60846492-60846514 GTGATTAAAGTGATCTTCAATGG - Intronic
955827872 3:62967313-62967335 GTGAGAAAACTGATGTTCTAAGG - Intergenic
955892732 3:63667107-63667129 ATGAGGAAACTGAAGCACAAAGG + Intronic
956437401 3:69247239-69247261 ATGAGGAAACTGAGGCTCAGAGG + Intronic
956936650 3:74109412-74109434 ATAAGGAAACTGAGGCTCAAAGG + Intergenic
959430336 3:106246559-106246581 TTGATAAAACTAATGCTCAAAGG + Intergenic
959973661 3:112434459-112434481 TTGAGTAAACTGAGGCTCAGAGG - Intergenic
960925397 3:122791123-122791145 AGGAGGAAACTGAGGCTCAAAGG + Intronic
960942157 3:122942228-122942250 ATGAGGAAACTGAGGCTCCAAGG + Intronic
961301589 3:125925375-125925397 ATGAGGAAACTGAGGCCCAAGGG - Intergenic
961824372 3:129591250-129591272 TTGAGTAAAATGAGGCTCAGAGG - Intronic
962071556 3:132038613-132038635 ATGAGAAAACTGAGGCTCAGAGG - Intronic
962107190 3:132403099-132403121 ATGAGGAAACTGAGGCACAAAGG + Intergenic
964671742 3:159233646-159233668 ATGATAAAACTGAGGCTCAAAGG + Intronic
965862670 3:173165986-173166008 AGTAGAAAACTGATGCTCAAAGG + Intergenic
966010849 3:175074773-175074795 GGGAGTAGACTGATGATCAGTGG + Intronic
966113954 3:176438572-176438594 GTGAGGAAACTGAAGTTCAGAGG - Intergenic
966533559 3:181006703-181006725 GTGAGTAATATGTTGCTCTATGG + Intergenic
966727763 3:183122979-183123001 ATGAGTAAACTGAGACTTAAGGG - Exonic
967529305 3:190530904-190530926 GTGAAAAAACTGAAGCTCAGAGG + Intronic
967843948 3:194029886-194029908 ATGAGGAAACTAAGGCTCAAAGG + Intergenic
968880533 4:3296536-3296558 GTGAGTAAACTAAGGCTCCCAGG - Intronic
968970494 4:3791180-3791202 GTGAGGAAACTGAGGCACAGAGG + Intergenic
969254827 4:5994588-5994610 GTGAGGAAACTGAGGCTCAGAGG + Intergenic
969390137 4:6886608-6886630 ATGAGTAAACTGAGGCACAATGG + Intergenic
969834355 4:9827915-9827937 ATGAGGAAACAGATGCTCAGTGG - Intronic
969838997 4:9866807-9866829 GTGGGTAAACTGATGCATGAGGG + Intronic
969943141 4:10754876-10754898 GGGGGGAAACTGAGGCTCAAAGG + Intergenic
970237643 4:13974595-13974617 ATGAGGAAACTGAGGCTCAGAGG - Intergenic
970383104 4:15528059-15528081 GTGTTTCAACTGATGCTCAAAGG + Intronic
970701403 4:18744523-18744545 GTGAGGAAACTGGAGCTCAGAGG + Intergenic
970966548 4:21934837-21934859 ATAAGTAAATTGAGGCTCAAAGG - Intronic
971159552 4:24120152-24120174 GTGAGGAAACTGAGGCTCCAGGG + Intergenic
971223576 4:24731249-24731271 ATGAGGAAACTGAGGCTCAGAGG - Intergenic
971300084 4:25434692-25434714 CTGAGTAAACTGAGGCTGAGTGG + Intergenic
972375698 4:38467999-38468021 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
973825906 4:54707495-54707517 GTGAGAAAACTGAGGCACACAGG - Intronic
973834274 4:54793446-54793468 GTAAGAAAACTGAAGCTCAGAGG + Intergenic
975038535 4:69713983-69714005 GTGAGAATACTGAAGCTCAGTGG - Intergenic
976510664 4:85905637-85905659 GGGAGAAGACTGATGCTCAGTGG - Intronic
976967771 4:91066314-91066336 GTGAGTCAACTGTTGCCAAATGG + Intronic
977286515 4:95114301-95114323 ATGAGGAAACTGAGGCTCAGGGG - Intronic
978198787 4:106000664-106000686 ATGAGGAAACTGAGGCTCAGGGG - Intronic
979346281 4:119591382-119591404 ATGAGGAAACTGAAGATCAAAGG + Intronic
979771755 4:124533623-124533645 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
980375101 4:131935630-131935652 TTGAGGAAACTGAGACTCAAAGG - Intergenic
981685137 4:147445886-147445908 GTAAATAAAATGATGCTTAAAGG + Intergenic
981903965 4:149898126-149898148 ATGAGGAAACTGAGGCCCAAAGG + Intergenic
982069942 4:151686251-151686273 GTGAGGAAACTGAGGGTCAGAGG + Intronic
983153694 4:164317790-164317812 GTGGGTAAACTGTGGATCAATGG + Intronic
983865134 4:172757472-172757494 GTGAGGAAACTGAGGCTTAGAGG + Intronic
984553115 4:181184059-181184081 ATGAGAAAACTGAGGCTTAAAGG - Intergenic
984688345 4:182696971-182696993 ATGAGTAAACTGAGGCACAGGGG - Intronic
986930023 5:12806074-12806096 GTAACAAAACTGATGATCAACGG - Intergenic
987342276 5:16949552-16949574 GTCAGCAAACTGAAGCTCAAGGG + Intergenic
988259701 5:28869621-28869643 TTGATTGTACTGATGCTCAAGGG + Intergenic
990760973 5:59128897-59128919 GTGAGGAAACTGATGCCCAAAGG + Intronic
991229124 5:64310438-64310460 GTGAGGAGACTGATACTCAGAGG - Intronic
991582783 5:68174173-68174195 GTGAAGAAACTGACCCTCAAAGG + Intergenic
991987601 5:72306174-72306196 GTAAGTAAACTGTTGATGAATGG + Intronic
992835863 5:80640806-80640828 ATGAGGAAACTGAGGCTGAATGG + Intronic
993585760 5:89725694-89725716 ATGAGTAAACTGAGTCTCAAAGG - Intergenic
993612142 5:90068099-90068121 GGGAGAAAACTGATTATCAAAGG - Intergenic
993643696 5:90436632-90436654 GTGATTAAACTGATGATACATGG - Intergenic
994383810 5:99103613-99103635 TTGAGGAAACTGAGGCACAAAGG - Intergenic
995061406 5:107814962-107814984 ATGAGTAAACGGAGACTCAAAGG + Intergenic
995404420 5:111778387-111778409 GTGAGGAAACAGAGGCTCACTGG + Intronic
995498381 5:112774297-112774319 TTGAGTAACATGATGCTCAAAGG + Intronic
995719045 5:115110520-115110542 GTGAGGAGACTGAGGATCAAAGG - Intergenic
996511776 5:124324571-124324593 GTGACTTATCTCATGCTCAATGG + Intergenic
997338873 5:133126960-133126982 ATGAGAAAACTGAGGCTCAAAGG - Intergenic
997541216 5:134664366-134664388 ATGAGTATAATGATGCTTAAAGG - Intronic
997582170 5:135024952-135024974 GGGAAGAAACTGAAGCTCAAAGG - Intergenic
997721755 5:136083486-136083508 ATGAGTAAACTGAGGCTCAAAGG + Intergenic
997893650 5:137696744-137696766 CTGAAGAAACTGGTGCTCAAAGG - Intronic
998601788 5:143592352-143592374 GTGAGGAAACTGAGGCTTAGGGG + Intergenic
998942541 5:147300231-147300253 CTGAAGAAACTGAGGCTCAAAGG + Intronic
999139410 5:149348011-149348033 ATGAGAAAACTGATGCTGAGAGG - Intronic
999291116 5:150427172-150427194 GTGAGGAAACTGAGGCACAAAGG - Intergenic
999411082 5:151350315-151350337 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
999646109 5:153718540-153718562 TTGAGGAAACTGAGACTCAATGG - Intronic
999708866 5:154298622-154298644 GTGAGAAAACTGGGGCTTAAAGG + Intronic
999805324 5:155075678-155075700 ATGAGAAAACTGAGGCTCAGAGG - Intergenic
999869591 5:155735474-155735496 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1000234762 5:159347095-159347117 GTAAGTCAACTGATGTTGAAAGG - Intergenic
1000335606 5:160239227-160239249 GTGGGTAAACTGAGGACCAAAGG - Intergenic
1000506595 5:162127809-162127831 GTGAGGAAACTGACGATCGAAGG + Intronic
1000999772 5:167994659-167994681 GTGAGAAAACTGACTCTCCAGGG + Intronic
1001227460 5:169957502-169957524 ATGAGAAAACTGAGGCTCAGAGG + Intronic
1001350116 5:170953833-170953855 GTGAGAAAACCAAGGCTCAAAGG + Intronic
1001383466 5:171318742-171318764 ATGAGTAAACTGAGGCTCTGAGG + Intergenic
1001412888 5:171523393-171523415 GTGAGAACACTGAGGCTCACAGG - Intergenic
1001465213 5:171958164-171958186 GTAAGGAAACCGAGGCTCAAAGG + Intronic
1001775836 5:174328526-174328548 ATGAGGAAACTGAGGCTGAAGGG + Intergenic
1001820674 5:174707796-174707818 GTGAGGAAACTGAGGCTCGGAGG - Intergenic
1002309265 5:178304801-178304823 ATGAGGAAACTGAGGCTCCAAGG - Intronic
1002832272 6:833455-833477 ATGAGGTAACTGAAGCTCAAAGG - Intergenic
1002832727 6:837611-837633 GTCAGGAAACTAAAGCTCAAAGG + Intergenic
1003120036 6:3311897-3311919 GTGGGGAAACTGAGGCCCAAAGG - Intronic
1004728591 6:18335379-18335401 ATGAGGAAACTGATTCTCAGAGG - Intergenic
1004762331 6:18681361-18681383 ATGGGGAAACTGATTCTCAAGGG + Intergenic
1005701717 6:28407859-28407881 GTGAGGCAACTGAAGCTCAATGG - Intergenic
1006501220 6:34460187-34460209 CTGAGGAAACTGAGGCTCATTGG - Intergenic
1006615958 6:35327079-35327101 GTGAGGAAACTGAGGCTCAGAGG - Intergenic
1006822248 6:36906434-36906456 ATGAGGAAACTGATGTGCAAGGG + Intronic
1007794476 6:44336607-44336629 ATGAGGAAACTGAGGCTCACAGG + Intronic
1008497506 6:52147685-52147707 TTGACTAAACTGTTTCTCAAAGG - Intergenic
1008886510 6:56436827-56436849 GTGAGAAAACTGAGGCTCACAGG + Intergenic
1008974212 6:57405385-57405407 TTGAGAAAACTGAAACTCAAAGG - Intronic
1009163101 6:60306908-60306930 TTGAGAAAACTGAAACTCAAAGG - Intergenic
1010918105 6:81645712-81645734 ATGACTAAACTGAGACTCAAAGG + Intronic
1011015066 6:82745340-82745362 ATGAGAAAACTGAAGGTCAAAGG - Intergenic
1012560275 6:100571653-100571675 ATGAGGAAACTGAGGCTCAGAGG + Intronic
1013065603 6:106682180-106682202 ATGAGGAAACTGAGGCTCACAGG - Intergenic
1013985730 6:116190993-116191015 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1014645984 6:123973391-123973413 GAGAGGAAAGTGAAGCTCAAAGG + Intronic
1016070008 6:139727304-139727326 GTGAGAAAATTGATGGTGAAAGG - Intergenic
1016428623 6:143959684-143959706 ATGAGGAAACTGAGGCTCAGAGG + Intronic
1016662512 6:146598242-146598264 GTGAGTAAACTGAGACTCAAAGG + Intergenic
1016707778 6:147133014-147133036 GTAAGAAAACTGAAGCTCAGAGG + Intergenic
1016883419 6:148934136-148934158 GTGAGGAAACTGGGGCTCAAGGG + Intronic
1017449012 6:154536546-154536568 ATGAGTAAATTGAGGCTCAGAGG - Intergenic
1019502498 7:1371367-1371389 ATGAGAAAACTGAGGCTCAGGGG + Intergenic
1020146992 7:5652249-5652271 ATGAGGAAACAGAGGCTCAAGGG + Intronic
1020432605 7:8128911-8128933 ATGAGCAAACAGAGGCTCAAGGG - Intronic
1020938707 7:14502931-14502953 GTAAGTAAACTGATCCTTTAGGG - Intronic
1021574905 7:22098083-22098105 GGTAGTAAACTAACGCTCAAAGG + Intergenic
1021980403 7:26048620-26048642 GAGAAGAAACTGAGGCTCAAAGG + Intergenic
1022298670 7:29081929-29081951 GAGAGGAGCCTGATGCTCAAGGG - Intronic
1022684206 7:32580001-32580023 GTGAGGAAACTAAAGCTCAGAGG + Intronic
1023342858 7:39240407-39240429 ATGAGGAAACTGAGGCACAAAGG - Intronic
1024062711 7:45710699-45710721 GTGAGGAAACTGAGGCACAGGGG + Intronic
1024091042 7:45939928-45939950 GTCAGCAAACTGCTGCTCAGGGG + Intergenic
1024287585 7:47772693-47772715 ATGAGTAAACTGAGGTCCAAGGG - Intronic
1025234963 7:57228189-57228211 ATGAGGAAACTGAGGCTCAGAGG - Intergenic
1026352796 7:69532334-69532356 ATGAGAAAACTGAGGCTGAAAGG + Intergenic
1026856865 7:73760942-73760964 ATGAGGAAACTGAGGTTCAAAGG + Intergenic
1027649199 7:80844485-80844507 GTAAGTAAACTGAGGTTCCAAGG - Intronic
1028118794 7:87033227-87033249 ATGAAGAAACTGAAGCTCAAAGG - Intronic
1028124384 7:87095111-87095133 ATGAGGAAAGTGATGTTCAATGG + Intergenic
1028972003 7:96869806-96869828 ATGAGAAAACTGTTGCTTAAAGG - Intergenic
1029010114 7:97250840-97250862 TTGAGGAAACTGGGGCTCAAAGG + Intergenic
1029409784 7:100401540-100401562 ATTAGAAAACTGAGGCTCAAAGG - Intronic
1029588466 7:101491110-101491132 GTGAGAAAATTGAGGCTCACAGG - Intronic
1030004307 7:105100584-105100606 GATAGAGAACTGATGCTCAAAGG + Intronic
1030303108 7:107993715-107993737 GTGATTAAACTGATGCTCATCGG - Intronic
1030918174 7:115343785-115343807 ATGAGAAAACTGATGCTCATGGG + Intergenic
1031463209 7:122077561-122077583 ATGAGGAAACTCTTGCTCAAAGG + Intronic
1031518743 7:122736421-122736443 GTGTGAAAACTGGTGCTCATAGG + Intronic
1031945138 7:127831674-127831696 GTGATGAAACAGATGCTCAAAGG + Intronic
1031984876 7:128157579-128157601 GTTAGAGAACTGATTCTCAAGGG - Intergenic
1032830988 7:135625520-135625542 ATGAGTGAAATGATCCTCAAAGG + Intronic
1033733160 7:144197613-144197635 GTGAGTAAACTTCTGATCTAGGG + Intergenic
1033749888 7:144353375-144353397 GTGAGTAAACTTCTGATCTAGGG - Intergenic
1033753460 7:144378224-144378246 ATGAGTAAACTGAAGCTCCAGGG + Intronic
1034962263 7:155370305-155370327 CTGAGGAAACTGAGGCACAAAGG - Intergenic
1035156238 7:156915632-156915654 GTGAGAAAACTGAGGCTCCTGGG + Intergenic
1035213553 7:157347553-157347575 GTGAGGAAACGGGGGCTCAAAGG - Intronic
1035328926 7:158084029-158084051 CTGAGTAAACTGAGGCCCAGCGG - Intronic
1036388551 8:8304624-8304646 GTGAGGAAACTGAAATTCAAGGG - Intergenic
1036758186 8:11485626-11485648 TTGAGAAAACTGAGGCTCAGTGG + Intergenic
1037286701 8:17309279-17309301 GTGATTAAACTTATGACCAAAGG + Exonic
1037527597 8:19742002-19742024 GTGAGGAAACTGAGGCCCAAAGG - Intronic
1037571819 8:20164521-20164543 ATGAGAAAAGTGATGCTCAGAGG + Intronic
1038510378 8:28128652-28128674 GTGATGAAACTGAAGCTGAAAGG - Intronic
1038901091 8:31844629-31844651 GTGAGTAAACTGATGCTCAAAGG - Intronic
1039771352 8:40690294-40690316 GTGAGAAAACTGAAGCCCAGAGG - Intronic
1039883522 8:41642257-41642279 ATGAGTAAACCGAGGCTCAGAGG + Intergenic
1041037116 8:53803917-53803939 GAGAGGAAACTGATGGTAAATGG - Intronic
1041948865 8:63477572-63477594 ATGAGAAAATTGATGCTCAGAGG + Intergenic
1042793625 8:72635936-72635958 ATGAGGAAACTGAGGCACAAAGG - Intronic
1044747616 8:95385876-95385898 GTGGGAAAACTGAGGCTCCAAGG - Intergenic
1045017657 8:98012862-98012884 ATGAGAAAACTGATGGTCAGAGG - Intronic
1045040115 8:98215597-98215619 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1045922711 8:107550061-107550083 GTGAGGAAACTGAGGCACAGAGG - Intergenic
1046533282 8:115474622-115474644 GTGAGTAATATTATGTTCAATGG + Intronic
1046634088 8:116652905-116652927 GTGAGCAACCTGAAGCCCAAAGG + Intronic
1046801017 8:118426692-118426714 GTAAGTAAACTACTGCTCCAAGG - Intronic
1047755087 8:127912368-127912390 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1047916495 8:129589555-129589577 ATGAGGAAACTGAGACTCAAAGG + Intergenic
1048138463 8:131769730-131769752 GTGAGGAAACTGAGGCCCAGAGG - Intergenic
1048174245 8:132137334-132137356 ATGAGGAAACTGAAGCTGAAAGG - Intronic
1048221483 8:132546314-132546336 AAGAGAAAACTGAGGCTCAATGG + Intergenic
1048263378 8:132964530-132964552 GGGAGTAACCTGATACACAAAGG - Intronic
1048604789 8:135956429-135956451 GTGAGGAAACTGAGGCTCAAAGG + Intergenic
1048826320 8:138430886-138430908 ATGAGGAAACTGAGGCTCAGAGG - Intronic
1049198488 8:141328424-141328446 ATGAGCAAACTGATGCTCCGAGG + Intergenic
1049420087 8:142512640-142512662 GTGAGGAAACTGAGGCTCAGAGG - Intronic
1049933936 9:482518-482540 ATGGGTAAACTGAGGCTCAGGGG + Intronic
1050629222 9:7541223-7541245 GTAAGCAAACTGATGATCATGGG - Intergenic
1050894365 9:10868369-10868391 GTGAGGAAACTGGGGCTTAAGGG - Intergenic
1051751654 9:20349212-20349234 ATGAGGAAACTGAGGCTCAAAGG - Intronic
1052047420 9:23810739-23810761 GTGAGGAAAATGAAGCTCAGAGG - Intronic
1052257532 9:26475953-26475975 GAGAGTCAATTGATGTTCAAGGG + Intergenic
1052459993 9:28750685-28750707 ATGAAGAAACTGAGGCTCAAAGG - Intergenic
1053297290 9:36923982-36924004 ATGAATAAACTGAGGCTCAAGGG + Intronic
1053640172 9:40066293-40066315 TTGAGGAAACTGAGACTCAAAGG - Intergenic
1053765962 9:41399184-41399206 TTGAGGAAACTGAGACTCAAAGG + Intergenic
1053887627 9:42656412-42656434 ATGAGAAAACTGAGGCTCAGGGG + Intergenic
1054226649 9:62463862-62463884 ATGAGAAAACTGAGGCTCAGGGG + Intergenic
1054320867 9:63662295-63662317 TTGAGGAAACTGAGACTCAAAGG - Intergenic
1054544575 9:66310341-66310363 TTGAGGAAACTGAGACTCAAAGG + Intergenic
1056135662 9:83627459-83627481 GTGAGAAAACTGAGGTTTAAAGG + Intronic
1056564794 9:87761721-87761743 GTGATGAAACTGAGGCTCAGAGG + Intergenic
1057207631 9:93183282-93183304 GTGAGGAAACTGAGGCACAAGGG - Intergenic
1058644020 9:107113818-107113840 ATGAGGAAACTGAGGCTCAGAGG - Intergenic
1058850177 9:109004161-109004183 CTAAGGAAACTGATGCTCAAAGG + Intronic
1059422667 9:114201982-114202004 TTGAGGAAACTGATGTTCAGAGG - Intronic
1059487498 9:114637950-114637972 ATGAATAAACTGAGACTCAAAGG - Intronic
1059581007 9:115548362-115548384 ATGAGTGAATTGAGGCTCAAGGG + Intergenic
1059581202 9:115550411-115550433 ATGAGTGAACTGAGGCTCAAGGG + Intergenic
1059666213 9:116448665-116448687 ATAAGGAAACTGAGGCTCAATGG - Intronic
1059897913 9:118889014-118889036 GTGAGAAAACTGAAACTCAGAGG + Intergenic
1060010188 9:120037012-120037034 ATGAGAAAACTGAGGCTCAGAGG - Intergenic
1060034510 9:120243429-120243451 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1060201122 9:121652177-121652199 CTGAGTAAACTGAGGCACAGTGG - Intronic
1060205708 9:121681604-121681626 GTGAGGAAACTGAGGTTCAGAGG + Intronic
1060664875 9:125426924-125426946 ATGAGGAAACTGAGGCTCAGAGG + Intergenic
1060691488 9:125664942-125664964 GTGAGAAAACTGGTGCTCAGAGG - Intronic
1060891877 9:127194225-127194247 ATGAGGAAACTGCAGCTCAAGGG + Intronic
1061008838 9:127943529-127943551 GTGAAGAAACTGAGGCTCAGAGG + Intronic
1061060370 9:128247214-128247236 GTGAGGAAACTGAGGCTGAGAGG + Intronic
1061204561 9:129155478-129155500 GTAAGGAAACTGAGGCTCAGAGG - Intergenic
1061211269 9:129194784-129194806 ATGAGGAAACTGAGGCTCAGGGG - Intergenic
1188028993 X:25243206-25243228 ATGAGGAAACTGAGGCTCAGAGG - Intergenic
1188760560 X:34023859-34023881 GTGAGAGAACTGAAGCTCAGAGG - Intergenic
1189031150 X:37452350-37452372 GTGAGGAAACTGAGGCCTAAAGG + Intronic
1189208515 X:39262862-39262884 GTGGGTAAGCTGATGCCCAAGGG - Intergenic
1191683860 X:63869097-63869119 ATGAGGAAACTGAAGCTCAGAGG - Intergenic
1192145718 X:68680950-68680972 GTGAGGAAACTGAGGCTCAGAGG + Intronic
1193184778 X:78499596-78499618 ATGAGGAAACTGAGGCTCAAAGG + Intergenic
1193212835 X:78827861-78827883 GTGAAGAAACTGAGGCTCAATGG - Intergenic
1194766664 X:97849532-97849554 ATGAGTAAACTGAGGCTCAACGG - Intergenic
1195253561 X:103071661-103071683 ATGAGTAAAATCATACTCAATGG + Intergenic
1195943402 X:110183446-110183468 ATGAGCAAACTGAGGCTCAGAGG - Intergenic
1196020713 X:110987934-110987956 ATGAGGAAACTGAAGCTCAGAGG - Intronic
1196912616 X:120499432-120499454 ATGAGGAAACTGAAGCTTAAAGG + Intergenic
1197220823 X:123911917-123911939 GTGAGGCAACTGAGACTCAAAGG + Exonic
1197417903 X:126197744-126197766 ATGATGAAACTGAAGCTCAAAGG - Intergenic
1198120478 X:133587843-133587865 GTGAGGAAACTGTGGCTCAGAGG + Intronic
1198388925 X:136154066-136154088 ATGAGGAAACTGAGGCTCAAAGG + Intronic
1198984915 X:142440014-142440036 ATGAGGAAACTGATGCTCAGAGG - Intergenic
1199535756 X:148901123-148901145 ATGAAGAAACTGATGCTCAAAGG + Intronic
1199575430 X:149309063-149309085 ATGAGGAAACTGAAGCACAAGGG - Intergenic