ID: 1038902201

View in Genome Browser
Species Human (GRCh38)
Location 8:31856840-31856862
Sequence CTCCAACAGAAGTGCAGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8380
Summary {0: 1, 1: 75, 2: 4031, 3: 2930, 4: 1343}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038902201_1038902203 -6 Left 1038902201 8:31856840-31856862 CCTCAGCTGCACTTCTGTTGGAG 0: 1
1: 75
2: 4031
3: 2930
4: 1343
Right 1038902203 8:31856857-31856879 TTGGAGTACCCGGCCGTGTGAGG 0: 111
1: 372
2: 1661
3: 1501
4: 1029
1038902201_1038902208 15 Left 1038902201 8:31856840-31856862 CCTCAGCTGCACTTCTGTTGGAG 0: 1
1: 75
2: 4031
3: 2930
4: 1343
Right 1038902208 8:31856878-31856900 GGTGTCAGTCTGCCCCTGCTGGG 0: 330
1: 2968
2: 1731
3: 1594
4: 1595
1038902201_1038902209 16 Left 1038902201 8:31856840-31856862 CCTCAGCTGCACTTCTGTTGGAG 0: 1
1: 75
2: 4031
3: 2930
4: 1343
Right 1038902209 8:31856879-31856901 GTGTCAGTCTGCCCCTGCTGGGG 0: 302
1: 2761
2: 1423
3: 602
4: 379
1038902201_1038902210 17 Left 1038902201 8:31856840-31856862 CCTCAGCTGCACTTCTGTTGGAG 0: 1
1: 75
2: 4031
3: 2930
4: 1343
Right 1038902210 8:31856880-31856902 TGTCAGTCTGCCCCTGCTGGGGG 0: 294
1: 2861
2: 1393
3: 588
4: 467
1038902201_1038902207 14 Left 1038902201 8:31856840-31856862 CCTCAGCTGCACTTCTGTTGGAG 0: 1
1: 75
2: 4031
3: 2930
4: 1343
Right 1038902207 8:31856877-31856899 AGGTGTCAGTCTGCCCCTGCTGG 0: 295
1: 2864
2: 1653
3: 1515
4: 1631

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038902201 Original CRISPR CTCCAACAGAAGTGCAGCTG AGG (reversed) Intronic
Too many off-targets to display for this crispr