ID: 1038903753

View in Genome Browser
Species Human (GRCh38)
Location 8:31873968-31873990
Sequence ACATTTTCATTGATGGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038903753_1038903756 12 Left 1038903753 8:31873968-31873990 CCTTGATCCATCAATGAAAATGT 0: 1
1: 0
2: 0
3: 22
4: 220
Right 1038903756 8:31874003-31874025 GAGTCTTCGATAAATATGTAAGG No data
1038903753_1038903755 -10 Left 1038903753 8:31873968-31873990 CCTTGATCCATCAATGAAAATGT 0: 1
1: 0
2: 0
3: 22
4: 220
Right 1038903755 8:31873981-31874003 ATGAAAATGTGATTTTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038903753 Original CRISPR ACATTTTCATTGATGGATCA AGG (reversed) Intronic
903357146 1:22755108-22755130 ACTTTCTCTTTGAGGGATCAGGG + Intronic
905077974 1:35291087-35291109 ACATTTTCATTTCTTGTTCATGG + Intronic
906493534 1:46286527-46286549 ACAGTTTCATGGATATATCATGG - Intronic
906589950 1:47015611-47015633 ATATTTTTATGGATGCATCAAGG - Intergenic
907741031 1:57165940-57165962 ACATTCTGATGGATGGGTCAGGG + Intronic
909351339 1:74656574-74656596 GCATTTTACTTGATGGATAATGG - Intronic
911032415 1:93503681-93503703 CCATTTTGATTGATGGAAAATGG + Intronic
911068003 1:93809368-93809390 AAATTTTCTTTGGGGGATCAAGG + Intronic
911879170 1:103212145-103212167 CCATGTCCATTGATGGATAAAGG + Intergenic
913270016 1:117084066-117084088 ATTTTTCCAATGATGGATCAGGG - Exonic
915507397 1:156366522-156366544 ACCTCTTCATTGCTGGATTATGG - Intronic
916238155 1:162611521-162611543 ACATTTTAATAGATGTGTCAGGG - Intergenic
917746303 1:178011322-178011344 ACATTTTCATTGTTGGGCCATGG - Intergenic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
1066050307 10:31628529-31628551 ACCTTTACATAGATGGATCGTGG - Intergenic
1066128711 10:32368507-32368529 ACCTTTTCCTTTATGGCTCAGGG + Intronic
1066293095 10:34031487-34031509 ACATTTTCATAGATAGAGGATGG - Intergenic
1067657014 10:48201575-48201597 ACAATTTGATTGATGAATGAAGG - Intronic
1068724446 10:60285579-60285601 ACATTTTCAGTGATGGGTTGAGG - Intronic
1069213133 10:65786752-65786774 ACAGTTACATTGAGGGATTAGGG + Intergenic
1069232183 10:66024435-66024457 ACAGTTTCATAGATTGATAATGG + Intronic
1071143221 10:82537287-82537309 ACATTTTCATGGAATGAACAGGG + Intronic
1071613306 10:87051740-87051762 ACCTTCACATAGATGGATCATGG - Exonic
1071854092 10:89605784-89605806 ACAATTCCTTTGATGGATCTGGG - Intronic
1075028641 10:119005501-119005523 ACATTTTCTTTGATGACTCATGG - Intergenic
1078958058 11:16226220-16226242 ATATTTACATTTAGGGATCAAGG - Intronic
1080023674 11:27591474-27591496 CCAGTTTCACTCATGGATCAAGG + Intergenic
1080471352 11:32548652-32548674 AAATTTTTATTGTTTGATCAAGG + Intergenic
1082706600 11:56500219-56500241 ACATTTTCCTTGAAGGGTTAGGG - Intergenic
1082925916 11:58547207-58547229 ATATTTTCATAGAAGGACCATGG - Intronic
1083028739 11:59572809-59572831 ACAGGTTCCTTGATTGATCAAGG - Intergenic
1085785955 11:79449641-79449663 ACATTTTAATTGATGTATTGAGG + Intergenic
1087262790 11:96029560-96029582 AGTTTTTCATTGTTGGAACAGGG + Intronic
1088427220 11:109716969-109716991 TCATTTGAATTGATGTATCAAGG - Intergenic
1088827060 11:113504817-113504839 CCATTTGCATTAATGAATCAAGG - Intergenic
1090210334 11:124916543-124916565 TGATGTTCATTCATGGATCAAGG + Intergenic
1090235048 11:125140803-125140825 AAATGGTCATTGATGGATTAGGG - Intergenic
1091048091 11:132343383-132343405 ACTTTCTCATTGATAGTTCAGGG - Intergenic
1091132954 11:133161922-133161944 ACACTTTCCTTGCTAGATCAGGG + Intronic
1092930795 12:13313859-13313881 ACATTCTCATTGTAGAATCAAGG - Intergenic
1093212706 12:16327054-16327076 ACCTTTTGATTGCTGGATTATGG + Intergenic
1093397559 12:18702093-18702115 ACATTTTCATTGCAATATCATGG - Intronic
1094002879 12:25715303-25715325 ACATTTGCCTTGATTCATCACGG - Intergenic
1094301504 12:28969714-28969736 CCATTTCCCTTGATGGAACATGG - Intergenic
1094463887 12:30729767-30729789 ACAGTGTCATTGATGTATAAGGG - Intronic
1096327909 12:50682282-50682304 ACATTTGCATTGTTGGGTAAGGG + Intronic
1099335138 12:81346867-81346889 ACATTTTTATTGATGGCATACGG - Intronic
1099868017 12:88308749-88308771 AAATTTTCATTGATGTAACTTGG + Intergenic
1101969410 12:109302317-109302339 ACATATTTATGGATGGATTATGG + Intronic
1102325509 12:111979110-111979132 ATTTTTTCTTTCATGGATCATGG - Intronic
1102698693 12:114820010-114820032 ACGTGTCCATTGATGGATAATGG - Intergenic
1103053219 12:117798833-117798855 ATATTTTCATTGATGGACACTGG - Intronic
1105379211 13:19871424-19871446 TTATTTTCATTGATAGAGCATGG + Intergenic
1107144378 13:37042470-37042492 ACATGTTTATGGATGGAACAGGG + Intronic
1107688368 13:42926923-42926945 TCTTTTCCATTTATGGATCATGG + Intronic
1108833546 13:54509611-54509633 ACATTTTGATTGATCAATAAAGG - Intergenic
1109447850 13:62468112-62468134 ATAATTTCATTGATAGATCAAGG - Intergenic
1109899185 13:68741438-68741460 ACATTTTCACTGAAGAATTAAGG + Intergenic
1110990309 13:82034351-82034373 CAATTTTCCTTGATGCATCAAGG + Intergenic
1112888631 13:104205403-104205425 ACATTTTCAACGATGCCTCAGGG - Intergenic
1115008899 14:28520844-28520866 TCATTTTCATTGCTGTATTATGG - Intergenic
1115456005 14:33602952-33602974 AATTTTACATTGTTGGATCATGG - Intronic
1115490246 14:33951343-33951365 ACATTTTCAGTGTGGGATCCAGG - Intronic
1115687346 14:35809541-35809563 ACATTTTCAAAGATAAATCATGG - Intergenic
1117094170 14:52280931-52280953 TCATTTTCCTTGATTGACCACGG + Intergenic
1117902771 14:60551992-60552014 ATTTTTTCTTTCATGGATCATGG + Intergenic
1117947351 14:61042499-61042521 ACATTTTCATTGATTAATTCTGG + Intronic
1118256960 14:64213869-64213891 AAAGTTTCATTGATGGTTAATGG - Intronic
1119242964 14:73077694-73077716 ACATGTTCATTGGTGAATCTAGG - Intronic
1120432692 14:84439196-84439218 CCATGTTAATTGATGGACCATGG - Intergenic
1123173951 14:106400255-106400277 ACATTTTCATTGTAGGGACATGG - Intergenic
1124446440 15:29738574-29738596 ATAGTTTCATGGAGGGATCAAGG - Intronic
1125416867 15:39462939-39462961 ACATTTTCTTTCATGACTCATGG - Intergenic
1125571245 15:40720022-40720044 TCATTTTCATTAATGGATACAGG + Intronic
1131018912 15:89081381-89081403 AAATGTCCATTGATGGATGAAGG - Intergenic
1134050288 16:11132449-11132471 AAATGTGCATTGATGGATGAAGG - Intronic
1134591721 16:15460020-15460042 ACATTCTCATTGATTTAGCATGG + Intronic
1137037611 16:35579768-35579790 CCCTCTTCATTGATGGATTATGG + Intergenic
1138723790 16:59113448-59113470 ACATATCCATTTATGTATCAAGG + Intergenic
1138764982 16:59591342-59591364 ACATTTTTGTTGATGGAATAGGG - Intergenic
1140869724 16:79095491-79095513 ACATTCTGACTGATGGACCAGGG - Intronic
1146040016 17:29443251-29443273 ACATTATCATTGTTGATTCAAGG + Intronic
1149413239 17:56430924-56430946 ACATTTACATTGATGGCTGAAGG + Intronic
1150038610 17:61833107-61833129 ACGTTTTCATTCATGGATACTGG - Intronic
1151036532 17:70806604-70806626 ATATTTTCTGTAATGGATCAGGG - Intergenic
1151798171 17:76360777-76360799 TCATTTTTACTGATGGGTCAGGG + Intronic
1155718311 18:28974948-28974970 ATATGTTCATTTATTGATCATGG + Intergenic
1156204657 18:34872689-34872711 ACCTTTTAGTTGCTGGATCATGG - Intronic
1156962152 18:43045407-43045429 ATGTTTTCATTGCAGGATCAGGG - Intronic
1157628766 18:49075426-49075448 AGATTTTCATCCAAGGATCAGGG + Intronic
1157914106 18:51647706-51647728 ACTTTTTTATTGATGGAGGATGG - Intergenic
1158569764 18:58588194-58588216 CCATTTTTACTGATGCATCAAGG + Intronic
1164396573 19:27869463-27869485 GCATGTTCATTGAGGCATCAGGG - Intergenic
1166256098 19:41605987-41606009 ACATTGTCATTGTTGGCTTAAGG + Intronic
1167815905 19:51880834-51880856 ACATTTTCAGTAATGGAAGAAGG - Exonic
1168466494 19:56606301-56606323 ATATGTTCATTGATGGTTCCTGG - Intronic
1168466596 19:56607180-56607202 ATATGTTCATTGATGGTTCTTGG + Intronic
925239663 2:2312769-2312791 ACATATTCATTGCTGCATCAAGG + Intronic
925731297 2:6920972-6920994 ACATTTTTATTTCTGGATCTTGG - Intronic
926037206 2:9645287-9645309 ACCCTTTCATTGCTAGATCAGGG - Intergenic
927334130 2:21901715-21901737 ACATTTTCATTCAAGGTTCTTGG - Intergenic
928044310 2:27912147-27912169 ACAATTTCATTGTTGGAACTGGG + Intronic
928180106 2:29062783-29062805 ACATTTTCATTACTGGAACCGGG - Exonic
930805164 2:55483176-55483198 ACATTTGCATTGCAGGACCATGG - Intergenic
931679633 2:64734641-64734663 CCATACTCATTGCTGGATCAGGG - Intronic
933503751 2:83150549-83150571 ACATCTTCAGTCATTGATCAGGG - Intergenic
935148387 2:100412178-100412200 TCATTTTCATTCATGGAGGAGGG + Intronic
936589457 2:113789247-113789269 CCAAATTAATTGATGGATCAAGG + Intergenic
937509042 2:122572425-122572447 ACAATTTCTTTGATGGAGAAGGG - Intergenic
939219289 2:139281397-139281419 AAAGTTTCCTTGATGGATCTTGG + Intergenic
940500167 2:154484031-154484053 ACCTTTTCATTGTTAGTTCAGGG - Intergenic
943145017 2:184032330-184032352 ACTTTTTCAGTGTGGGATCAGGG + Intergenic
943714190 2:191132563-191132585 ACATTATCCTTGTTGTATCATGG - Intronic
945137941 2:206649806-206649828 ATCTTTTCATTGAAGGATTAGGG + Intergenic
1169971210 20:11271122-11271144 ACATTTTAATGGGTGAATCAAGG - Intergenic
1170351497 20:15446894-15446916 ACATTTTCATTGTTTTATGAAGG - Intronic
1170735306 20:19009063-19009085 AAATTTTCATAGATGGGCCATGG + Intergenic
1170774362 20:19362900-19362922 ACATTTTCATTGTTCAATCATGG - Intronic
1170925028 20:20714629-20714651 ACATTTTCATTACTGGGTAAAGG - Intergenic
1171089632 20:22271657-22271679 TCATTTTCACTGAGGGATGAGGG - Intergenic
1171108810 20:22461687-22461709 ACATTTTCATTGATTACTAAAGG + Intergenic
1172112217 20:32553585-32553607 ACATTTACATTTAGGGTTCATGG + Intronic
1172590284 20:36112918-36112940 ACATCAACATTGGTGGATCAGGG + Intronic
1173034954 20:39399758-39399780 ATATTTTCATAGATAGATCAGGG - Intergenic
1175147460 20:56907690-56907712 TCATTTTGACTGGTGGATCAGGG - Intergenic
1175565615 20:59974371-59974393 ACATTTTAAATGATGTATTAAGG + Intronic
1177521035 21:22226235-22226257 ACATCTTAGTTGATGGAACAAGG + Intergenic
1179204463 21:39261532-39261554 ACATTTGTACTGATGGATCATGG - Intronic
1185350223 22:50332132-50332154 CCATTTTCTTTCATGGATTATGG + Intergenic
949135184 3:555992-556014 ACATTTTCCTTGTTTTATCATGG + Intergenic
949632818 3:5947342-5947364 ATATTTACATAGATGGATAAAGG - Intergenic
951723256 3:25724887-25724909 AGATTTTCATTCATGGTTCCTGG + Intronic
952072104 3:29649695-29649717 ACATTGTCATTCATGAAACAAGG + Intronic
954700360 3:52447665-52447687 CCAATTTCATGGATGGAACAGGG + Intergenic
955054726 3:55445110-55445132 CCATTTTTATTCATGGAGCAGGG - Intergenic
956204863 3:66744719-66744741 GCATTTTGAGTCATGGATCATGG - Intergenic
957262639 3:77921217-77921239 ACATTTTCATGTATGGATATGGG + Intergenic
958137634 3:89517124-89517146 CAATTTTCATAAATGGATCATGG + Intergenic
958499740 3:94889706-94889728 TCATTTTCATTGATTGTTCATGG + Intergenic
958621008 3:96559893-96559915 ACATTTTAATAAATGGTTCAGGG + Intergenic
960712798 3:120547604-120547626 ACATATTGATTGATGTCTCATGG - Intergenic
963580685 3:147123022-147123044 ACATTTTCATTGGAAGAACACGG + Intergenic
963608004 3:147429579-147429601 AGATTTTCATTGCTGGGTGATGG + Intronic
963650196 3:147969495-147969517 ACATTTTTATTGGGGGAACAGGG - Intergenic
964397228 3:156258180-156258202 ACACTCTCATTGATGGAGCTGGG + Intronic
965092976 3:164184962-164184984 ATATTTTCATATATGGTTCAGGG + Intergenic
965547801 3:169933531-169933553 ACATTTTCATAGATGAATACTGG + Intronic
967650603 3:191981141-191981163 ACATTTTTATTGATTTATCCTGG - Intergenic
970271358 4:14351380-14351402 ACATATTAATTGATGCCTCATGG - Intergenic
970914080 4:21311935-21311957 ACATTGTGATTCATAGATCATGG - Intronic
971562736 4:28101871-28101893 ACATTTTCATTCATGGTTCTTGG + Intergenic
972763613 4:42131388-42131410 ACATTTTAATTGTGGGATTAGGG + Intronic
972867048 4:43245516-43245538 ACATTTTCTTGGATGATTCATGG - Intergenic
972936291 4:44139974-44139996 GAATTTTCAGTGATGGGTCAAGG - Intergenic
974232851 4:59138972-59138994 AGATTTTCACTGGTGGTTCATGG - Intergenic
977318965 4:95486932-95486954 CCATTCTCATGAATGGATCAAGG + Intronic
977635511 4:99293603-99293625 ACATTTTTGTTGAGGGCTCATGG + Intergenic
977770657 4:100854496-100854518 ACATTTTCAAGAATGGTTCATGG + Intronic
978228892 4:106374108-106374130 ACATTTTCTTTTCTGCATCATGG - Intergenic
979942305 4:126777051-126777073 ACTCTTTCCTTGACGGATCATGG + Intergenic
981441407 4:144787005-144787027 ACATTTTCATTAGTGAATAATGG - Intergenic
983024541 4:162716928-162716950 AGATTTTAATTGATAGATCCAGG + Intergenic
983075562 4:163321765-163321787 ACATGTTGTTTGATGGATCATGG + Intergenic
983235201 4:165171348-165171370 ACATTTTCATGGCTGCAACAGGG + Intronic
986473629 5:8101004-8101026 ACTGTTTGATAGATGGATCAAGG + Intergenic
988112625 5:26842467-26842489 ACATTTTCACTGATACATAATGG - Intergenic
988186108 5:27864399-27864421 ACAATTTCTCTGATGGATCTGGG - Intergenic
988196275 5:28010093-28010115 ACATTGTATTTTATGGATCAAGG + Intergenic
988313734 5:29596224-29596246 CCATTTTCATAGGTGGATTAAGG - Intergenic
992315280 5:75546572-75546594 ACTTTTTTATTGATGCATAACGG + Intronic
992471215 5:77056617-77056639 TCATTTTTATAGATGGTTCAAGG - Intronic
992559954 5:77941509-77941531 ACATCTCCAGTGATGAATCATGG + Intergenic
992755477 5:79901659-79901681 CTATTTTCATTGATGGAGTAAGG + Intergenic
992862369 5:80924436-80924458 AAATTTTCTTTTATGGATCATGG - Intergenic
993026637 5:82654544-82654566 TCATTTTCTTTAATGGAACAAGG - Intergenic
994427616 5:99612684-99612706 ATCTTTTCATTTATGAATCATGG + Intergenic
996217501 5:120887302-120887324 ACACTTTCCTGGATGGCTCACGG - Intergenic
998709804 5:144810539-144810561 ACATTTTCTCTGATGAAACACGG + Intergenic
999277686 5:150342518-150342540 ACATTTTAGTTGTTGGATCATGG - Intergenic
999506238 5:152200123-152200145 ACCTTTTCTTTGATAGATCATGG + Intergenic
999998797 5:157118103-157118125 ACATTCTCATAGATGAATCCTGG + Intronic
1000363611 5:160470631-160470653 ACAAGTTCATTGCTGAATCATGG + Intergenic
1003169819 6:3712563-3712585 ACATTGTGCTTGATGGATGACGG + Intergenic
1008174502 6:48250784-48250806 AAGTTTCCAATGATGGATCAGGG + Intergenic
1008358564 6:50586624-50586646 ACACTCTCAGTGATGGATCCTGG + Intergenic
1009573425 6:65420058-65420080 TCATGGTCACTGATGGATCAGGG + Intronic
1010115521 6:72303222-72303244 AAATTTTAAATGATGGATTAGGG + Intronic
1011994781 6:93572184-93572206 ATATTATCAATGATTGATCAAGG - Intergenic
1012196561 6:96348852-96348874 ATATTTTCCTTAATGTATCAGGG - Intergenic
1012308589 6:97691606-97691628 ACATTTTCATATATTGAACAGGG - Intergenic
1012465640 6:99514279-99514301 GCATTTTCACTGATGGAGGAAGG - Intronic
1014335500 6:120129020-120129042 ACATTTTCTTTGATGGAGGCTGG - Intergenic
1015305536 6:131702677-131702699 ACATTTTAATTGTGGGATCAAGG - Intronic
1016653904 6:146495824-146495846 ACATTCGCTTTGATGGAGCAAGG - Intergenic
1018045103 6:159958992-159959014 ACATTTTCTTTAAGGGATCAAGG + Intergenic
1018408709 6:163517837-163517859 ATATTTTCATTGATGAGTGAGGG + Intronic
1018499356 6:164388938-164388960 ACTTTTTCATTGAAGGCTCCTGG + Intergenic
1019754338 7:2757732-2757754 ACATTTTCCTTTATGCTTCATGG - Intronic
1020786069 7:12573920-12573942 TCATTTACATTGCTGGAGCATGG + Intronic
1022254446 7:28641845-28641867 TCGTTTTTATGGATGGATCATGG + Intronic
1022743806 7:33149164-33149186 AGGCTTTCATTGATGGAGCAGGG + Intronic
1024411800 7:49051625-49051647 AAATTCTCATTGATGGATAATGG + Intergenic
1024781141 7:52849831-52849853 ACATTTTCATAGATGCACCATGG + Intergenic
1031150695 7:118050588-118050610 ACAGTTTCCTTGATGTATCTGGG + Intergenic
1033026096 7:137774244-137774266 ACATTTTCACTGTTGGAAAAGGG + Intronic
1033384215 7:140855581-140855603 ACATTTTCTTTAAGGGATGAGGG - Intronic
1033739651 7:144260908-144260930 ACATTTTAATTGTGGGATCAAGG - Intergenic
1036088144 8:5636032-5636054 ACATTTTATTTGATGGGTCTGGG + Intergenic
1038903753 8:31873968-31873990 ACATTTTCATTGATGGATCAAGG - Intronic
1040420402 8:47234574-47234596 AATTTTTCTTTTATGGATCATGG - Intergenic
1040896067 8:52369654-52369676 ACATTTTAAATGTTGAATCAGGG - Intronic
1042711476 8:71722306-71722328 GCAGTTTCATTGCTGTATCAAGG - Intergenic
1044326714 8:90867257-90867279 CCATTTTCAATAATGGATTAGGG + Intronic
1045172197 8:99684112-99684134 ATTTTTACATTGATTGATCAAGG + Intronic
1045663149 8:104458774-104458796 ACATGTTCATAGAAGGATCTAGG - Intronic
1046892052 8:119432889-119432911 ACTCTATTATTGATGGATCAAGG - Intergenic
1047077191 8:121417561-121417583 ACATTTACATTGATGTATTAGGG - Intergenic
1047887985 8:129274118-129274140 TGATATTTATTGATGGATCATGG - Intergenic
1050096973 9:2077048-2077070 ACACCTTCAGTGAAGGATCAGGG - Intronic
1050454060 9:5815768-5815790 ACATTTTCATCGTTTGATTAAGG - Intronic
1050597050 9:7214388-7214410 CCATATTCAGTGATGGGTCAGGG - Intergenic
1051870904 9:21736370-21736392 AAATTTACATTGATGCATCCAGG - Intergenic
1052617421 9:30858641-30858663 ACATATACATAGATGGATAACGG - Intergenic
1053513180 9:38706881-38706903 ACATTTTCATTCATAGAACCAGG + Intergenic
1056172779 9:84004181-84004203 ATATTTTCATTGTTGTATCAGGG + Intergenic
1058363130 9:104174312-104174334 ACATTTTCTTTGAGGCTTCAGGG + Intergenic
1185499668 X:587230-587252 ACGTTTTCATTGCTGGAGCACGG + Intergenic
1186080035 X:5921046-5921068 ACATCTTCATTGCTGAAGCATGG + Intronic
1186779478 X:12898544-12898566 ACCTTGTCATTGATGGGACAGGG - Intergenic
1186999511 X:15160615-15160637 AAATTTTCTTTGAGGGATGAAGG - Intergenic
1189262207 X:39687097-39687119 ACCTTTTCATTGTTGGATGGAGG + Intergenic
1191926083 X:66311637-66311659 AAATTTTGATGGATGGAACAAGG + Intergenic
1192669409 X:73123993-73124015 ACATTTTCAGTGCTGGAAGAAGG + Intergenic
1193100514 X:77606219-77606241 ACATTTTCATTTTAGGTTCAGGG - Intronic
1194195444 X:90885897-90885919 ACCTTTTCCATGATGAATCATGG - Intergenic
1194593166 X:95826025-95826047 AAATTTTTTTTAATGGATCATGG + Intergenic
1195105850 X:101600807-101600829 GCATTGTGATTGATGGCTCAGGG - Intergenic
1195107033 X:101612960-101612982 GCATTGTGATTGATGGCTCAGGG + Intergenic
1196965433 X:121049350-121049372 ACCTTCACATAGATGGATCATGG + Exonic
1197438013 X:126456271-126456293 AGATTTTCATTCAAGGCTCAAGG - Intergenic
1198309684 X:135418375-135418397 TCCTTTTTATTTATGGATCATGG - Intergenic
1198552568 X:137760193-137760215 GCATGTTCAATTATGGATCAGGG + Intergenic
1200287822 X:154840446-154840468 ACTTTTTCAAGGCTGGATCAAGG - Intronic