ID: 1038904793

View in Genome Browser
Species Human (GRCh38)
Location 8:31888315-31888337
Sequence ACACCCTTCTGTACTGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 77}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038904793 Original CRISPR ACACCCTTCTGTACTGATAT AGG (reversed) Intronic
903861974 1:26370155-26370177 ACCCCCTTCTGTGCTGAGAGGGG + Intronic
907818747 1:57946213-57946235 ACACAGTTCTGTTCTGATAAAGG - Intronic
907941340 1:59090688-59090710 ACACCCTTCACTACTAATATTGG - Intergenic
920168740 1:204055812-204055834 CCACCCTTCATTCCTGATATTGG + Intergenic
920702770 1:208230470-208230492 ACACCCTTCTGTGCTGCCACAGG - Intronic
923361535 1:233216573-233216595 AAACCCTTCTATACTGCTAGGGG + Intronic
1063876884 10:10488932-10488954 ACACCCTCCTCTACTGAAAGTGG + Intergenic
1065083533 10:22151291-22151313 TCACCCTTCTCTCCTGATAGTGG - Intergenic
1072016944 10:91357240-91357262 ACACTCTACTGTTCTGAGATTGG + Intergenic
1072109749 10:92307270-92307292 ACACTCTTATATGCTGATATCGG + Intronic
1076102296 10:127792703-127792725 ACCCCCTTCTTTTCTGAGATGGG - Intergenic
1080941117 11:36919435-36919457 ACACACATCTGTACTGGTGTGGG - Intergenic
1082218250 11:49601025-49601047 GCACCCTCCTGTACTATTATGGG - Intergenic
1085291678 11:75404797-75404819 CCACCCTTCTGTTCTGAGATGGG - Exonic
1085715425 11:78868690-78868712 AAACTCACCTGTACTGATATTGG - Intronic
1086631318 11:89023094-89023116 GCACCCTCCTGTACTATTATGGG + Intronic
1088450315 11:109974708-109974730 ACACCAATCTGCACTGATGTGGG - Intergenic
1092729272 12:11513005-11513027 ACACCCTTCTTCACTGAGACTGG - Intergenic
1097627747 12:62021613-62021635 CCACCCTTCTGTTCTGAGATGGG + Intronic
1103283615 12:119781726-119781748 ACAGCCTTCTGCACTCAGATAGG + Intronic
1109552651 13:63924339-63924361 ATAACCTTCTGTACTGCTTTTGG - Intergenic
1109828732 13:67757447-67757469 CCACCCTTCACTAGTGATATTGG - Intergenic
1110415852 13:75251460-75251482 TCACCATTTTGAACTGATATAGG + Intergenic
1112048208 13:95618214-95618236 ACTCCCTTCTGTACTGTAAGCGG + Intronic
1115030251 14:28785677-28785699 AAAGCCTTCTGTACTGTGATGGG + Intronic
1127337939 15:58008753-58008775 TTACCTTTCTGTACTGATACAGG + Intronic
1131473067 15:92713073-92713095 AAACCCTTGTGTACTGCTATGGG + Intronic
1133571858 16:7048937-7048959 ACACCCAACAGAACTGATATTGG - Intronic
1140839506 16:78825938-78825960 CCACCCTTCTGTTCTGAGATGGG - Intronic
1143196351 17:5078841-5078863 ACTCCCTTCTGTACCGAGGTGGG + Intronic
1147589454 17:41672342-41672364 AAACCCATCTATACTGAGATGGG - Intergenic
1148343264 17:46886185-46886207 ACAGCTTTCTGTACTGATATGGG - Intronic
1149279675 17:55088901-55088923 ACACACTTCTCTACTGTTAGAGG - Intronic
1151514883 17:74586919-74586941 ACACCCTTCTTTACGGAGGTTGG + Intronic
1155978928 18:32160761-32160783 ACACCCTCCTGAACTGTTCTGGG - Intronic
1156042599 18:32839696-32839718 ACACCATACTGTAATGTTATAGG + Intergenic
1157405253 18:47417463-47417485 ACACCCACTTCTACTGATATTGG + Intergenic
1157406777 18:47428410-47428432 ACAGGCTTCTGTGGTGATATGGG - Intergenic
1157569226 18:48701281-48701303 ACACACTTCTGAACTGAAAATGG - Intronic
1158699088 18:59730459-59730481 AGATCCTTCTGGAATGATATGGG + Intergenic
1160197915 18:76772189-76772211 ACAACCTTCTGTACTGTTCGCGG + Intergenic
1166141518 19:40807805-40807827 ACACCTTTCTGTCCTGATGCTGG - Exonic
943569449 2:189556013-189556035 ACACCCTCCTGTTCTGATATTGG - Intergenic
944150350 2:196552003-196552025 TCACCCTTCTCTACTTATCTGGG + Intronic
1170227140 20:14003633-14003655 CCACCCTTCTGTTCTGAGACGGG - Intronic
1176986295 21:15441419-15441441 GCACCCTTTTGTGCTGACATCGG + Intergenic
951246061 3:20342945-20342967 ACAGCAATCTGAACTGATATGGG + Intergenic
957579263 3:82049840-82049862 ACATCTTTCTGTAATGATTTCGG - Intergenic
957767388 3:84643736-84643758 ACACACTTCTGTAAGAATATAGG + Intergenic
958959854 3:100498834-100498856 AGACCCTTGTGTACTGCTGTAGG - Intronic
962328283 3:134454304-134454326 ACACCCTTCTGTGGTGAGAGTGG - Intergenic
966285089 3:178286293-178286315 ACACTCTTCTGTTATAATATTGG + Intergenic
966848666 3:184150367-184150389 CCACCCTTCTGTTCTGAGATGGG - Intronic
968074905 3:195810877-195810899 ACACCCTTGTGTACAGAGCTGGG - Intronic
970478196 4:16446141-16446163 ACACCCTTGTGTATTGCTAATGG - Intergenic
977504183 4:97880850-97880872 GCATCCTTCTGAACTGGTATTGG - Intronic
978399338 4:108314345-108314367 ACACCCTTCTTGATTGTTATTGG + Intergenic
983868727 4:172799644-172799666 ACACCCTTGTGTACTGTTGCTGG + Intronic
988653908 5:33185879-33185901 CTACCCTTCTGTATTGACATTGG - Intergenic
990837310 5:60036390-60036412 ACACCCTTTTTTCCTGATACAGG - Intronic
991999968 5:72426537-72426559 AACCCTTTATGTACTGATATGGG - Intergenic
992071396 5:73152459-73152481 CCACCCTTCTATTCTGAGATGGG + Intergenic
992633273 5:78701999-78702021 TCACTCTTCTGTATTGATTTTGG - Intronic
992803078 5:80310620-80310642 GTACCCTTTTGTATTGATATAGG - Intergenic
993671912 5:90770727-90770749 ACATCCTTCTGTACTGACTGAGG - Intronic
998899325 5:146835736-146835758 ACACTGTACTGTACAGATATCGG + Intronic
1000497867 5:162008408-162008430 AAACACTTTTGTACTGATGTTGG - Intergenic
1003580770 6:7338882-7338904 CCACCCTTCTGTTCTGAGATGGG + Intronic
1009658892 6:66583905-66583927 AGACCCTTCTATACCAATATAGG + Intergenic
1015401918 6:132797047-132797069 ACAGGTTTTTGTACTGATATCGG - Exonic
1018437674 6:163777444-163777466 CCACCCCCCTGTACTGTTATGGG - Intergenic
1031282632 7:119823204-119823226 TCACCATTCTGTAATGGTATTGG - Intergenic
1038330974 8:26609204-26609226 AAATCCTTCTGTACAAATATGGG - Intronic
1038904793 8:31888315-31888337 ACACCCTTCTGTACTGATATAGG - Intronic
1041208810 8:55525473-55525495 AAACCCTTCTGAACTGAGAGAGG + Exonic
1043873434 8:85460774-85460796 ACATCCTTCTATCCTAATATTGG - Intergenic
1044190298 8:89308482-89308504 AAACCCATCTGTACTCATAAAGG + Intergenic
1044552032 8:93523384-93523406 AAACCCTTCTCTCCTGTTATTGG - Intergenic
1047166227 8:122441449-122441471 ACACCCATCTTTAGTGATTTGGG - Intergenic
1047449118 8:124947533-124947555 ACCCACTTCTGTGCTGTTATTGG - Intergenic
1052280117 9:26723505-26723527 AAACTCTTCTGAACTGTTATGGG + Intergenic
1055494237 9:76838682-76838704 GAACCCATCTGTACTGCTATGGG + Intronic
1187690167 X:21858457-21858479 TCTAACTTCTGTACTGATATAGG - Exonic
1190254120 X:48749827-48749849 AAACCCTTATGTACTGTTATTGG + Intergenic
1190551139 X:51582215-51582237 ACACCTTTCATTCCTGATATTGG + Intergenic
1193644747 X:84053807-84053829 ACACACTTCTGGACTGGAATAGG - Intergenic
1193820357 X:86155141-86155163 ACACCCTTCTGTAATCAATTTGG - Intronic
1194960931 X:100234995-100235017 ACACCATTGTGTAATTATATCGG + Intergenic