ID: 1038906630

View in Genome Browser
Species Human (GRCh38)
Location 8:31911573-31911595
Sequence GGGTCTTACCAGATGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038906624_1038906630 11 Left 1038906624 8:31911539-31911561 CCACATGGGCACATAGAGGGGAG 0: 1
1: 3
2: 8
3: 37
4: 240
Right 1038906630 8:31911573-31911595 GGGTCTTACCAGATGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038906630 Original CRISPR GGGTCTTACCAGATGGAGGA GGG Intronic
No off target data available for this crispr