ID: 1038906630 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:31911573-31911595 |
| Sequence | GGGTCTTACCAGATGGAGGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1038906624_1038906630 | 11 | Left | 1038906624 | 8:31911539-31911561 | CCACATGGGCACATAGAGGGGAG | 0: 1 1: 3 2: 8 3: 37 4: 240 |
||
| Right | 1038906630 | 8:31911573-31911595 | GGGTCTTACCAGATGGAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1038906630 | Original CRISPR | GGGTCTTACCAGATGGAGGA GGG | Intronic | ||
| No off target data available for this crispr | |||||