ID: 1038910152

View in Genome Browser
Species Human (GRCh38)
Location 8:31954328-31954350
Sequence TAGGATAATAAAGCTTTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038910148_1038910152 11 Left 1038910148 8:31954294-31954316 CCATAGCTAGTCAATGGCAAAGT 0: 1
1: 0
2: 1
3: 29
4: 171
Right 1038910152 8:31954328-31954350 TAGGATAATAAAGCTTTTACTGG No data
1038910147_1038910152 12 Left 1038910147 8:31954293-31954315 CCCATAGCTAGTCAATGGCAAAG 0: 1
1: 0
2: 10
3: 65
4: 275
Right 1038910152 8:31954328-31954350 TAGGATAATAAAGCTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038910152 Original CRISPR TAGGATAATAAAGCTTTTAC TGG Intronic
No off target data available for this crispr