ID: 1038923370

View in Genome Browser
Species Human (GRCh38)
Location 8:32110927-32110949
Sequence TCTTATCATTAGAAAGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038923365_1038923370 25 Left 1038923365 8:32110879-32110901 CCCAGAAGCATTGCTGTCTGGAG 0: 1
1: 0
2: 2
3: 19
4: 178
Right 1038923370 8:32110927-32110949 TCTTATCATTAGAAAGTGAAAGG No data
1038923366_1038923370 24 Left 1038923366 8:32110880-32110902 CCAGAAGCATTGCTGTCTGGAGA 0: 1
1: 0
2: 0
3: 25
4: 236
Right 1038923370 8:32110927-32110949 TCTTATCATTAGAAAGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038923370 Original CRISPR TCTTATCATTAGAAAGTGAA AGG Intronic
No off target data available for this crispr