ID: 1038933175

View in Genome Browser
Species Human (GRCh38)
Location 8:32217983-32218005
Sequence ACTCTGACTTCAACACTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038933175_1038933179 22 Left 1038933175 8:32217983-32218005 CCTGTGAGTGTTGAAGTCAGAGT 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1038933179 8:32218028-32218050 ACCACCTATTTGAAAAATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038933175 Original CRISPR ACTCTGACTTCAACACTCAC AGG (reversed) Intronic
903022897 1:20406340-20406362 ACTGTGGCTTTAACACTCCCTGG - Intergenic
904708992 1:32414269-32414291 ACTCTGCCTTCAACAATTAGGGG + Intergenic
905466111 1:38154827-38154849 GATCTGACTCCACCACTCACTGG - Intergenic
906849504 1:49233170-49233192 ACTTTGACTTCATAAATCACAGG + Intronic
907479594 1:54736297-54736319 ACTCTTAATTCAACATCCACAGG + Intronic
907904639 1:58773239-58773261 ACCTTGACTTCAATACTCCCAGG + Intergenic
908705132 1:66945392-66945414 CCTCTGTCTTCAACACGTACAGG - Intronic
910285110 1:85545121-85545143 ACTCTGCCCTCCATACTCACAGG + Intronic
910298407 1:85676554-85676576 CCTTTCACTTGAACACTCACAGG + Intronic
913247426 1:116882229-116882251 ACTGTAACTTCAATACGCACTGG + Intergenic
915065384 1:153220264-153220286 ATCCTGACTTCACCACTTACTGG - Intergenic
917019986 1:170575873-170575895 ACTGTGACATCAACCCTAACAGG + Intergenic
919317928 1:195999071-195999093 ACTCTTGATTCACCACTCACAGG + Intergenic
922380403 1:225017790-225017812 ACTCTCACTTCAACACTCCTGGG - Intronic
1068940893 10:62680078-62680100 CCTTTCACTTCAACACTCAGAGG + Intergenic
1070205552 10:74256016-74256038 ACTCTGATTACAACACCCAAAGG - Intronic
1071158813 10:82722609-82722631 ACCCTGAGCTCAACACACACAGG + Intronic
1072166684 10:92820363-92820385 CCTCTCACTTGAACACTTACAGG + Intergenic
1072912670 10:99517905-99517927 CCTTTCACTTCAACACTTACGGG + Intergenic
1074758750 10:116648103-116648125 TCTCTGACCTCAACACTTACTGG + Intergenic
1077057976 11:605190-605212 CCACTGGCTTCAACACTGACGGG - Exonic
1080428665 11:32178799-32178821 AAGCTGACCTCAACATTCACAGG - Intergenic
1081848912 11:46261143-46261165 ACCCTGACTTCAGCACCCACTGG - Intergenic
1082766657 11:57173957-57173979 ACTAATACTTCACCACTCACTGG - Intergenic
1082848496 11:57744937-57744959 ACTCTGACTTCACCACTGGGTGG + Exonic
1085455412 11:76662661-76662683 GGTCTGACTTCCACAATCACCGG + Intronic
1085678616 11:78549343-78549365 AGCCTGACTCCAACACTGACTGG + Intronic
1086734241 11:90285988-90286010 ACTCTAACTTGAACACTTAGAGG + Intergenic
1088952678 11:114587170-114587192 ACTCTGTCTTCAACAATGAGGGG + Intronic
1088971383 11:114777529-114777551 AATCTGTCTTCAACACTCCCAGG - Intergenic
1098261858 12:68679803-68679825 TGTCTGACTTCAACCTTCACTGG - Intergenic
1098896735 12:76071275-76071297 CCTCTGACTTCCACCCTCCCAGG + Intronic
1100176715 12:92038869-92038891 ACTCTGACTTTAAAATTCAGAGG - Intronic
1103174413 12:118849781-118849803 ATTCTCCCTTCATCACTCACTGG - Intergenic
1103374649 12:120446405-120446427 ACTCTGATGTCATCACTCTCAGG + Exonic
1103764982 12:123273379-123273401 ACTCTGACTCCCCCACCCACTGG + Intergenic
1104378579 12:128287058-128287080 ACTCTGACTGCAAAACTTAAAGG - Intronic
1104432673 12:128729285-128729307 AATCTGACTTCATGACCCACCGG - Intergenic
1105526827 13:21185663-21185685 ACTCAGAACTCAACACTCCCTGG + Intergenic
1105994945 13:25661737-25661759 AATCAGATTTCAACACCCACTGG - Intronic
1108005276 13:45939929-45939951 ACTCTGACTCCAACACGAACAGG - Intergenic
1112887225 13:104189143-104189165 ACACAGACTTCATCACTCGCAGG - Intergenic
1112928665 13:104708571-104708593 ACTCTGACTTCAAAAGGCCCAGG - Intergenic
1113201765 13:107874321-107874343 TCTCAGACTTCAAAACCCACAGG + Intergenic
1114152968 14:20065223-20065245 ACAATGACTTCAACAGTCACAGG + Intergenic
1116060307 14:39915841-39915863 ATTCTGTCTTCACTACTCACTGG + Intergenic
1119965425 14:78910250-78910272 ACTCTGCCTCCACCTCTCACTGG + Intronic
1119967045 14:78928280-78928302 ATTCTGACTTCATTACTTACAGG + Intronic
1121018730 14:90565745-90565767 CCTTTCACTTGAACACTCACAGG + Intronic
1124141617 15:27081966-27081988 ACTCTAACTTAAGCACTCTCTGG - Intronic
1125981373 15:44004735-44004757 CCTCTTACTTGAACACTTACAGG - Intronic
1126514654 15:49521217-49521239 ACTCTGACTTTGGCAATCACAGG + Intronic
1127304034 15:57684487-57684509 ACTCTGACTTAGGCACTCAGAGG + Exonic
1127627064 15:60789990-60790012 ATTCTGGCTTCAACACTTATCGG - Intronic
1128920472 15:71605730-71605752 CCTCAGACTTTTACACTCACTGG - Intronic
1131086737 15:89581922-89581944 ACTCTGACTTGCCCACCCACAGG - Intronic
1131173016 15:90191769-90191791 ACACTGCCTTCAAAACTCACTGG - Intronic
1131630160 15:94167646-94167668 GGTATGATTTCAACACTCACAGG + Intergenic
1132294704 15:100726606-100726628 ACCCTGAGTCCAACACACACTGG + Intergenic
1133240670 16:4412450-4412472 ACTCTGACTTCAGGCCCCACAGG + Intronic
1134445935 16:14331416-14331438 ATTCTGACTTCACCACTTAATGG + Intergenic
1134603010 16:15548283-15548305 ACTCGGAATTCACCACGCACAGG - Intronic
1136771938 16:32847756-32847778 TCCCTGACCACAACACTCACAGG - Intergenic
1136898671 16:34013765-34013787 TCCCTGACCACAACACTCACAGG + Intergenic
1137760152 16:50934042-50934064 ACTCTGACATCAACTCTGATTGG + Intergenic
1139832158 16:69808820-69808842 ACGCTGACATAAACACTCTCAGG + Intronic
1140040882 16:71406922-71406944 ACTGTGACCACAACACTCACAGG + Intergenic
1140694790 16:77521954-77521976 ACCCTGACTTCCTCATTCACGGG + Intergenic
1141484187 16:84328061-84328083 GCTCAGACTTCAACCCCCACAGG - Intronic
1141512789 16:84523633-84523655 ACAGTGACTTGAATACTCACAGG - Intronic
1141954948 16:87364494-87364516 ATTCTGACTTCCACATTGACAGG - Intronic
1203074359 16_KI270728v1_random:1109845-1109867 TCCCTGACCACAACACTCACAGG - Intergenic
1142794037 17:2293016-2293038 ACACTAACTTCAACCCTCAAAGG + Intronic
1145806390 17:27736086-27736108 CCTTTCACTTGAACACTCACAGG - Intergenic
1147426966 17:40350560-40350582 TCTCTGACATCATCAATCACCGG - Intronic
1148207210 17:45786555-45786577 ATTCTGACTTCACTACTCACTGG - Intronic
1151886603 17:76926488-76926510 ACTCTGACTCCACCACTGGCTGG + Intronic
1152274207 17:79344938-79344960 CCTCTGACTGCAAAACTCAGAGG + Intronic
1152449455 17:80367761-80367783 ACTCTGACGTGAAGACGCACGGG + Exonic
1153574573 18:6507739-6507761 ACTCTGACTCCAACAGTCAAAGG - Intergenic
1154134240 18:11761779-11761801 ACCCTGACTGCACCCCTCACAGG + Intronic
1155348881 18:24886324-24886346 CCTCTGACTTCACCATTCAGAGG - Intergenic
1157661395 18:49448147-49448169 ACTCTGCCTTCAACAATTAGGGG + Intronic
1158702451 18:59760701-59760723 ATTCTGACGTCAACATCCACTGG - Intergenic
1162373417 19:10291894-10291916 ACCCCGACTTCAACCCTCGCCGG + Intronic
1163268498 19:16235295-16235317 ACTATGACATAAACACACACAGG - Exonic
1165041025 19:33067522-33067544 AATCTAATTTCAGCACTCACAGG + Intergenic
1168616621 19:57842838-57842860 AGTCTGGCTTCAAAACTCACAGG + Intronic
926207201 2:10842265-10842287 ACACTGACCTCTACACTCCCAGG + Intergenic
927293278 2:21425101-21425123 ATTCTGATTTCTCCACTCACCGG - Intergenic
927781033 2:25939503-25939525 ACACTGTCTTCAATTCTCACAGG + Intronic
928446524 2:31338199-31338221 ACTCTGACACCAACATTTACAGG + Intronic
929278874 2:40056214-40056236 ACCCTGTCTTTACCACTCACTGG - Intergenic
930375627 2:50562700-50562722 TTTCTTACTTCAACACTCAGGGG + Intronic
931220465 2:60284293-60284315 ACCCTGACCTCTCCACTCACTGG + Intergenic
933124334 2:78585584-78585606 ATTCTGACTTCAACAAGGACAGG + Intergenic
941662719 2:168211842-168211864 ATTCTGACACAAACACTCACTGG + Intronic
945018818 2:205550235-205550257 ACGCTGTCTTCAACTCTCCCAGG + Intronic
945224709 2:207521762-207521784 ATTCTGACTCTGACACTCACTGG + Intergenic
947682111 2:232044322-232044344 ACTGTGACTTCATCTCTCACTGG - Intronic
1168805956 20:672560-672582 TCTCTGACCTCCACATTCACAGG + Intronic
1168973122 20:1944620-1944642 CCTCTGCCTGCAACACTCCCTGG + Intergenic
1169043480 20:2516450-2516472 ACTCTGACTTTAATCCTCACTGG - Intronic
1169653883 20:7900626-7900648 ATTCTGACTGCTCCACTCACTGG + Intronic
1169840038 20:9925869-9925891 AAACTGACTGCAACACTCAAAGG + Intergenic
1170736353 20:19016899-19016921 AGTCTTACTTCAGCACTCCCAGG + Intergenic
1171043940 20:21792769-21792791 CCTCTCACTTCCACTCTCACAGG - Intergenic
1173118018 20:40264534-40264556 ACTCTGAGCTCAAAACTCCCTGG - Intergenic
1175138343 20:56841628-56841650 ACCCTGACACCAAGACTCACAGG - Intergenic
1175725480 20:61315357-61315379 GCTCTGAGCTCCACACTCACTGG - Intronic
1176915477 21:14620657-14620679 ATTCTGAGATCAACAGTCACTGG - Intronic
1177432829 21:21012966-21012988 ACTCTGACTGCTCCACTGACTGG + Intronic
1178605687 21:34034773-34034795 ACTCTGAGGTCTAGACTCACTGG - Intergenic
1179189436 21:39110153-39110175 CATCTGGCTTCAACAATCACGGG - Intergenic
1179577138 21:42315055-42315077 ACCCTGATTTCAACACAGACTGG + Intronic
1181460104 22:23080840-23080862 CCTCTGTCATCAGCACTCACTGG + Intronic
1181695303 22:24589949-24589971 ACTCTCTCTTCACCACTCACAGG - Exonic
1181959239 22:26611002-26611024 ACCCTGACCTCAGCACACACAGG + Intronic
1182486265 22:30640906-30640928 ACTCTGACTTCAATCTTCCCTGG - Intronic
1182825645 22:33262568-33262590 ACTCTGAGTCCAACATTGACAGG - Intronic
950308589 3:11936088-11936110 CCTCTGACTTGAACACAGACAGG + Intergenic
952392403 3:32891492-32891514 TCACTGACTTCAACAACCACCGG + Exonic
953716514 3:45320888-45320910 ATTCTGACTTCACCATTCAGGGG - Intergenic
955352340 3:58203120-58203142 ACTCTTACCTCAACAGACACGGG + Intronic
956801959 3:72767622-72767644 ACTCTGTCCTCAAGACTTACTGG + Intronic
957290841 3:78276409-78276431 ATTCTTTCTTCAACTCTCACAGG + Intergenic
957645266 3:82914077-82914099 ACTCTCACTTAAACACTTAGAGG - Intergenic
958020856 3:87994240-87994262 TCTCTGACCTCAAAACTGACAGG + Intergenic
958452517 3:94291802-94291824 ACTCTGCCTTCAATACACAATGG + Intergenic
959056565 3:101573650-101573672 TCTCTGACCTCAACTCTTACAGG + Intergenic
959294981 3:104523429-104523451 ACTCAGACTTCAACATTCGGGGG - Intergenic
959667749 3:108940728-108940750 ACTCTGACCTCAGCCCTCACAGG - Intronic
963348934 3:144129448-144129470 TCACTCACTTAAACACTCACTGG - Intergenic
964104102 3:153021088-153021110 GCACTGACATCAACACACACAGG + Intergenic
964395192 3:156238045-156238067 GCTCTGACTTCCACCCTCCCAGG - Intronic
968570166 4:1335435-1335457 ACTCTGATTTCAACACACTGTGG - Intronic
968570237 4:1336204-1336226 ACTCTGATTTCAACACTCTGCGG - Intronic
968570260 4:1336478-1336500 ACTCTGATTTCAACACACTGTGG - Intronic
969147301 4:5135336-5135358 ATTCTCACTCCAACACTCAGTGG - Intronic
969418093 4:7074112-7074134 ACCCTGGCTCCAGCACTCACTGG - Intergenic
969446649 4:7248485-7248507 ATTCTGTCTTCAATTCTCACAGG - Intronic
969899480 4:10335799-10335821 ATTCTTACTTCAACATTCAGGGG - Intergenic
970977962 4:22062806-22062828 ACTCTGATTTCAGCACTGCCAGG - Intergenic
971186323 4:24380574-24380596 GCTCTGACTTCAACAAGCAGAGG + Intergenic
971524945 4:27604940-27604962 TCTCTCACTTGAACACTTACGGG - Intergenic
972904344 4:43727033-43727055 ATTCTGGCTCCAACACTTACTGG - Intergenic
974040990 4:56857403-56857425 ATCCTCACTTCAACACTGACAGG - Intergenic
975035152 4:69670211-69670233 ACTCTTACTTCAACTTTCAAAGG - Intergenic
975525745 4:75348555-75348577 ATGCTAACTTGAACACTCACTGG + Intergenic
976605318 4:86977157-86977179 TCTGTGACTTCAGGACTCACTGG - Intronic
976703948 4:88002349-88002371 ACTCAGACTTCATCTCTCCCTGG - Intergenic
977239130 4:94545020-94545042 AACCTGACTTCATCACTTACTGG + Intronic
978160577 4:105542484-105542506 AAACTGAGTTCAACAGTCACTGG + Intergenic
978169650 4:105654148-105654170 ACTCTGTCTTCAACACATACAGG + Exonic
979925123 4:126553233-126553255 AATCTCACTTCATCACTCACTGG - Intergenic
980640216 4:135567109-135567131 ACTCTGACTCCAAAAGTTACAGG - Intergenic
980642310 4:135596512-135596534 ATTCTGACTTCAACAATTAGGGG + Intergenic
981208801 4:142076081-142076103 ACTATGGCCTCCACACTCACAGG + Intronic
982325780 4:154127070-154127092 ACTCAGGCTTCAAGAGTCACAGG - Intergenic
982364919 4:154567053-154567075 ATTCTGACCTCAAGATTCACAGG - Intronic
984479643 4:180283017-180283039 TCCCTGACTTGAACACACACAGG + Intergenic
987396350 5:17428264-17428286 ACCCTCACTTCAACAATGACTGG - Intergenic
987632903 5:20498556-20498578 ACTGTGAGTTAAACACTCATAGG - Intronic
991487664 5:67154871-67154893 ACTCTGATTTCAAGAGTCACTGG - Intronic
991929324 5:71736590-71736612 ACTCAGAAATAAACACTCACTGG - Intergenic
991977489 5:72197433-72197455 TCACTGAATTCAAAACTCACTGG - Exonic
992074550 5:73179007-73179029 ACTCTGACTGCTCCACCCACTGG + Intergenic
994114990 5:96051660-96051682 ACACTAACCTCATCACTCACAGG - Intergenic
994427361 5:99607431-99607453 ACTCTGAATTCAATACTAGCTGG - Intergenic
996698450 5:126423912-126423934 TCTCTTAATTCAAAACTCACTGG + Intronic
996942772 5:129029060-129029082 AATCTTTCTTCAACACTCAGTGG - Intronic
999835393 5:155364793-155364815 ACTGTGACTTTAACACACAGTGG + Intergenic
999942430 5:156558539-156558561 ACACTGACTATACCACTCACCGG + Intronic
1008069094 6:47081117-47081139 ACACAGACTTCACCACTCAGTGG + Intergenic
1008241696 6:49120819-49120841 ATTCTGTCTTCCAAACTCACAGG - Intergenic
1009771457 6:68147553-68147575 ATTCTGACTTTGCCACTCACTGG + Intergenic
1011287358 6:85739164-85739186 ACTCTGACTTCAACAAGAACAGG + Intergenic
1011693042 6:89887526-89887548 ACTCTGCCCTCAACTCGCACAGG + Intergenic
1012318065 6:97805335-97805357 ACTCTTACCTCAGCACCCACTGG + Intergenic
1014436390 6:121425307-121425329 ACTCTGACTTCACCTCTGAGAGG + Intergenic
1016887810 6:148974449-148974471 ACTCTGTCTGAAACACTCATTGG - Intronic
1022682398 7:32561833-32561855 ACTCTTACTTAAACACTTAGAGG + Intronic
1023706065 7:42942892-42942914 AATCTGCCTTCACCTCTCACAGG - Intronic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1029544525 7:101203213-101203235 TCTTTGACTTCCACCCTCACAGG - Intergenic
1031124478 7:117757621-117757643 ATTCTGATTGCATCACTCACTGG - Intronic
1031445653 7:121850333-121850355 AATCTGACTTCCACTCTCAAAGG + Intergenic
1035333748 7:158112828-158112850 CCTCTGACCTCTGCACTCACAGG - Intronic
1035699072 8:1624431-1624453 ACTCTGTATTAAACACGCACAGG + Intronic
1037278791 8:17212127-17212149 AATCTGACCTCAACATTCAAAGG - Intronic
1037893831 8:22638608-22638630 ACTCTGTGTTCAACTCTCTCTGG - Intronic
1038187345 8:25287094-25287116 GCTTTGCCTTCAATACTCACAGG - Intronic
1038933175 8:32217983-32218005 ACTCTGACTTCAACACTCACAGG - Intronic
1039594138 8:38775989-38776011 TCTTTGGCTTCAACACTAACTGG - Intronic
1043155640 8:76775777-76775799 AGTGTGCCTGCAACACTCACAGG - Intronic
1043675713 8:82950035-82950057 ACACTGATTTTAACATTCACTGG - Intergenic
1045429399 8:102098890-102098912 ACACTGACTTCATCTCTCACTGG + Intronic
1046036908 8:108853552-108853574 AATCTGTCTTCACCACCCACAGG + Intergenic
1046216969 8:111161444-111161466 ACTGTGACCTCAAGACTCAATGG + Intergenic
1046749387 8:117911024-117911046 TTTCTGACTGCAAGACTCACTGG + Intronic
1047227782 8:122971015-122971037 AGTCGGGCTTCACCACTCACTGG + Intronic
1048931392 8:139318279-139318301 ATCCTGACTTCACCACTAACTGG + Intergenic
1050257238 9:3807891-3807913 ACACTGACTTCAACATCCTCAGG + Intergenic
1051100749 9:13518286-13518308 ACTCTGCCTTCCACAGTCAGAGG + Intergenic
1058174243 9:101719697-101719719 ACTCTGTCTTTAACACTTGCAGG - Intronic
1060206822 9:121687091-121687113 CCTGGGACTTCAACACTCACTGG - Intronic
1060391953 9:123285104-123285126 ATTCTAACTTGAACTCTCACTGG + Intergenic
1060729144 9:126026146-126026168 ACACTGACTTCACCACTTCCAGG + Intergenic
1186771772 X:12825426-12825448 ACACAGACTTCACCACTTACCGG + Intergenic
1186847619 X:13546045-13546067 ATTCTGACTTCAAGACTTCCAGG + Intergenic
1192981029 X:76341558-76341580 TCTTTGACTTCAACACTTAGAGG - Intergenic
1199591015 X:149468547-149468569 ATTCTGACTCCAACCCTGACTGG - Intergenic