ID: 1038933522

View in Genome Browser
Species Human (GRCh38)
Location 8:32221486-32221508
Sequence ATAAATAGTAAGATGGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038933518_1038933522 29 Left 1038933518 8:32221434-32221456 CCTCTAAATGTGATTTAACTCGC 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1038933522 8:32221486-32221508 ATAAATAGTAAGATGGGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038933522 Original CRISPR ATAAATAGTAAGATGGGGTA AGG Intronic
No off target data available for this crispr