ID: 1038942942

View in Genome Browser
Species Human (GRCh38)
Location 8:32325604-32325626
Sequence CAGGAGAATCACTTATGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194904
Summary {0: 1, 1: 102, 2: 3346, 3: 51966, 4: 139489}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038942942_1038942947 0 Left 1038942942 8:32325604-32325626 CCTGGGCATAAGTGATTCTCCTG 0: 1
1: 102
2: 3346
3: 51966
4: 139489
Right 1038942947 8:32325627-32325649 CCTCGGCTTCCCAAAGTGCTGGG 0: 3993
1: 134688
2: 280173
3: 206103
4: 120380
1038942942_1038942951 25 Left 1038942942 8:32325604-32325626 CCTGGGCATAAGTGATTCTCCTG 0: 1
1: 102
2: 3346
3: 51966
4: 139489
Right 1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG No data
1038942942_1038942948 8 Left 1038942942 8:32325604-32325626 CCTGGGCATAAGTGATTCTCCTG 0: 1
1: 102
2: 3346
3: 51966
4: 139489
Right 1038942948 8:32325635-32325657 TCCCAAAGTGCTGGGAATATAGG 0: 157
1: 29316
2: 321644
3: 251807
4: 144361
1038942942_1038942945 -1 Left 1038942942 8:32325604-32325626 CCTGGGCATAAGTGATTCTCCTG 0: 1
1: 102
2: 3346
3: 51966
4: 139489
Right 1038942945 8:32325626-32325648 GCCTCGGCTTCCCAAAGTGCTGG 0: 2437
1: 91192
2: 218517
3: 223243
4: 148875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038942942 Original CRISPR CAGGAGAATCACTTATGCCC AGG (reversed) Intronic
Too many off-targets to display for this crispr