ID: 1038942944

View in Genome Browser
Species Human (GRCh38)
Location 8:32325623-32325645
Sequence GCACTTTGGGAAGCCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716174
Summary {0: 2528, 1: 94523, 2: 229713, 3: 234424, 4: 154986}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038942944_1038942951 6 Left 1038942944 8:32325623-32325645 CCTGCCTCGGCTTCCCAAAGTGC 0: 2528
1: 94523
2: 229713
3: 234424
4: 154986
Right 1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038942944 Original CRISPR GCACTTTGGGAAGCCGAGGC AGG (reversed) Intronic
Too many off-targets to display for this crispr