ID: 1038942946

View in Genome Browser
Species Human (GRCh38)
Location 8:32325627-32325649
Sequence CCCAGCACTTTGGGAAGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 737744
Summary {0: 3727, 1: 127451, 2: 269477, 3: 209897, 4: 127192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038942946_1038942951 2 Left 1038942946 8:32325627-32325649 CCTCGGCTTCCCAAAGTGCTGGG 0: 3727
1: 127451
2: 269477
3: 209897
4: 127192
Right 1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038942946 Original CRISPR CCCAGCACTTTGGGAAGCCG AGG (reversed) Intronic
Too many off-targets to display for this crispr