ID: 1038942949

View in Genome Browser
Species Human (GRCh38)
Location 8:32325636-32325658
Sequence GCCTATATTCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724231
Summary {0: 115, 1: 21843, 2: 250376, 3: 273107, 4: 178790}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038942949_1038942951 -7 Left 1038942949 8:32325636-32325658 CCCAAAGTGCTGGGAATATAGGC 0: 115
1: 21843
2: 250376
3: 273107
4: 178790
Right 1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038942949 Original CRISPR GCCTATATTCCCAGCACTTT GGG (reversed) Intronic
Too many off-targets to display for this crispr