ID: 1038942950

View in Genome Browser
Species Human (GRCh38)
Location 8:32325637-32325659
Sequence TGCCTATATTCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 620831
Summary {0: 61, 1: 11400, 2: 115871, 3: 246416, 4: 247083}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038942950_1038942951 -8 Left 1038942950 8:32325637-32325659 CCAAAGTGCTGGGAATATAGGCA 0: 61
1: 11400
2: 115871
3: 246416
4: 247083
Right 1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038942950 Original CRISPR TGCCTATATTCCCAGCACTT TGG (reversed) Intronic
Too many off-targets to display for this crispr