ID: 1038942951

View in Genome Browser
Species Human (GRCh38)
Location 8:32325652-32325674
Sequence TATAGGCATGTGCCCACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038942946_1038942951 2 Left 1038942946 8:32325627-32325649 CCTCGGCTTCCCAAAGTGCTGGG 0: 3727
1: 127451
2: 269477
3: 209897
4: 127192
Right 1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG No data
1038942950_1038942951 -8 Left 1038942950 8:32325637-32325659 CCAAAGTGCTGGGAATATAGGCA 0: 61
1: 11400
2: 115871
3: 246416
4: 247083
Right 1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG No data
1038942949_1038942951 -7 Left 1038942949 8:32325636-32325658 CCCAAAGTGCTGGGAATATAGGC 0: 115
1: 21843
2: 250376
3: 273107
4: 178790
Right 1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG No data
1038942944_1038942951 6 Left 1038942944 8:32325623-32325645 CCTGCCTCGGCTTCCCAAAGTGC 0: 2528
1: 94523
2: 229713
3: 234424
4: 154986
Right 1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG No data
1038942942_1038942951 25 Left 1038942942 8:32325604-32325626 CCTGGGCATAAGTGATTCTCCTG 0: 1
1: 102
2: 3346
3: 51966
4: 139489
Right 1038942951 8:32325652-32325674 TATAGGCATGTGCCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038942951 Original CRISPR TATAGGCATGTGCCCACACC TGG Intronic
No off target data available for this crispr