ID: 1038943798

View in Genome Browser
Species Human (GRCh38)
Location 8:32335093-32335115
Sequence CCACTTCAGTTTAAATCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038943798_1038943802 12 Left 1038943798 8:32335093-32335115 CCATAGGATTTAAACTGAAGTGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1038943802 8:32335128-32335150 TAATTTGCAGAGAATGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038943798 Original CRISPR CCACTTCAGTTTAAATCCTA TGG (reversed) Intronic
904785982 1:32983363-32983385 CCACTTCAGTGAAGACCCTAGGG - Intergenic
907822782 1:57987500-57987522 ACACTTCAGTTTGAATCTTGGGG - Intronic
909562217 1:77019563-77019585 CCACTTCAAGTTAATTCCAAAGG + Intronic
910155526 1:84214167-84214189 CCACTTCAGTTCAGATCTCAAGG + Exonic
910818318 1:91316965-91316987 CCACTTCATTCTAAATACAATGG - Intronic
911361236 1:96879417-96879439 CCACTTCAATTTAAATATTGAGG - Intergenic
915558343 1:156672747-156672769 CCACTCCAGTTTAGAGGCTAAGG - Exonic
915916125 1:159942003-159942025 CCTCTTTAGTTTGAATCCTGAGG - Intronic
917178772 1:172269074-172269096 CAACTCCAGTTTAAATCCTTGGG - Intronic
918996904 1:191773471-191773493 CCATTTCATAGTAAATCCTAAGG + Intergenic
921054000 1:211530572-211530594 CCACATCAGGTTAAATAATATGG + Intergenic
1064703511 10:18046651-18046673 CCACTCCAGTTACACTCCTAAGG + Intergenic
1065443611 10:25775201-25775223 CCACTAGAGTGTAAGTCCTAGGG + Intergenic
1067128598 10:43541427-43541449 ACACTTCAGTTTAGATTTTAGGG + Intergenic
1067323106 10:45241000-45241022 CCACCTGAGTTTATTTCCTAAGG + Intergenic
1072758418 10:98036309-98036331 CCTCGTCAGTTTCCATCCTAAGG + Intergenic
1074227067 10:111494821-111494843 CCACTCCAGTTTGAATTCTAAGG - Intergenic
1076272789 10:129169325-129169347 ACACTTCAGTCAATATCCTAAGG + Intergenic
1079017754 11:16883892-16883914 CCAATTCAGTGTCAATCCCAGGG + Intronic
1088267697 11:108003306-108003328 CTAATTCAGCTTAAATCCAAGGG + Intergenic
1090244910 11:125209303-125209325 CCACTTCAGTATAATGCCTATGG + Intronic
1093428627 12:19057818-19057840 CCACTTTAGATTAAATCCTTTGG + Intergenic
1095499012 12:42816194-42816216 CCACTTAATTTTAAAACCCAGGG - Intergenic
1095875024 12:47070836-47070858 CCACTTTAGTTGAATTCCCATGG + Intergenic
1097307805 12:58088380-58088402 CCAGTTAAATTTAAATCCTGAGG + Intergenic
1099023128 12:77431709-77431731 CAATGTCAGTTTTAATCCTAGGG - Intergenic
1099049964 12:77770158-77770180 CCAGTGCTGTTAAAATCCTAGGG + Intergenic
1102734039 12:115141525-115141547 CCCCCTCATTTTAAACCCTAGGG + Intergenic
1104318501 12:127726977-127726999 AGACTTCAGATTAAATTCTAAGG - Intergenic
1106970692 13:35138320-35138342 TCATTTCAGTTTTTATCCTAAGG + Intronic
1107161178 13:37230062-37230084 CCAATTTAGAGTAAATCCTAGGG - Intergenic
1108568687 13:51728294-51728316 CCTTTTCAGGTTAAAACCTAAGG + Intronic
1109927451 13:69163017-69163039 CCACTTCCGTTTCAAGCCTCTGG + Intergenic
1112135526 13:96574258-96574280 TGAATTCAGTTTAAATCCCATGG - Intronic
1116291241 14:43044709-43044731 TCACATTAGTTTAAATGCTATGG + Intergenic
1119059763 14:71462614-71462636 CCACTTCAGTAAAATTTCTAGGG - Intronic
1126308682 15:47290370-47290392 TCATTTCAGTTTAATTCCCATGG - Intronic
1126519180 15:49571076-49571098 CCATTTCTGTTTATATCCAAAGG - Intronic
1130764897 15:86859957-86859979 CAACTTCAGATTTAATCCTCTGG - Intronic
1134313090 16:13093892-13093914 CCACACCTATTTAAATCCTATGG - Intronic
1134770235 16:16802015-16802037 ATTCTTCAGTTTAAATCCCAGGG + Intergenic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1137361652 16:47822173-47822195 CCAGTCCTATTTAAATCCTATGG - Intergenic
1139752491 16:69118155-69118177 CCACATCAGTTTAAATTTTGAGG + Exonic
1140950514 16:79812551-79812573 CTTCTTCAGTTCAGATCCTAGGG + Intergenic
1141080294 16:81045440-81045462 GCACTACTGCTTAAATCCTACGG - Exonic
1142690560 17:1603954-1603976 ACACTTCAGTTTGGATCCCACGG + Intronic
1147176376 17:38658603-38658625 CCACTTCAGTCTAATCCCTGTGG - Intergenic
1147881732 17:43658768-43658790 CCCCTTCAGTTAAATTCCAAAGG + Intronic
1154400005 18:14027488-14027510 CCACTTCCATTTAAATCCCCTGG - Intergenic
1156105054 18:33649714-33649736 CCACATCAGCTTAAATTCTATGG - Intronic
1158755359 18:60317802-60317824 CCACTCCAGTTTATAACCTTAGG - Intergenic
1159658253 18:71058721-71058743 ACACTTCTGATTATATCCTAAGG + Intergenic
925525222 2:4792947-4792969 CCACTTCAGTTGAAACTCTGGGG - Intergenic
926512802 2:13803368-13803390 CCAATACAGTATAAATGCTAAGG + Intergenic
926603681 2:14875105-14875127 CCACTTCACTCAAGATCCTAGGG + Intergenic
933278436 2:80306037-80306059 CCTCTTCAGCTTAGATGCTAAGG - Intronic
939967638 2:148626092-148626114 CCATTTCAGCTCAACTCCTATGG - Intergenic
943731350 2:191306500-191306522 CCACAGCAGTTCAAATCCCAAGG - Intronic
944724650 2:202458060-202458082 CACCTTCAGTTTAAATGATATGG + Intronic
945313361 2:208341925-208341947 CCACTACACTATAAACCCTATGG + Intronic
945476228 2:210285401-210285423 CCACTTCAGCTTAGGTACTAGGG + Intergenic
945668314 2:212770056-212770078 AAACTTGAGTTTAAATCATAAGG + Intergenic
946940818 2:224768676-224768698 TAACTTCAGTTTAAATCATGAGG + Intronic
946972656 2:225112416-225112438 CTACTTCTCTTTAAACCCTAAGG + Intergenic
1171879825 20:30610473-30610495 CTACTACAGTGTAAATGCTAAGG - Intergenic
1173931465 20:46823667-46823689 ACACTTCAGTTCAAGTCCAAAGG + Intergenic
1177551543 21:22628878-22628900 CCACTACAGTGTAAAAGCTAAGG - Intergenic
1178669322 21:34577071-34577093 CAACTGCAGTTTCCATCCTACGG + Intronic
1182346420 22:29669188-29669210 GCATTTCATTCTAAATCCTAGGG - Intronic
954961083 3:54565467-54565489 CCAGTTCAATTTATGTCCTAAGG + Intronic
957550090 3:81692827-81692849 CAACTTAATTTTAAATCTTAAGG + Intronic
960038858 3:113128999-113129021 CCACTTCACTTTGAAGCGTAAGG + Intergenic
961136463 3:124516122-124516144 CCACTTCAGGTTAGGTCCTCAGG + Intronic
965060675 3:163781668-163781690 CCACTTCAAATTATATCATAAGG - Intergenic
966195715 3:177311969-177311991 CAACATCAGTTAAAATACTATGG - Intergenic
967467274 3:189822405-189822427 CCATTTCAGATTAAACCCTCAGG - Intronic
971884039 4:32420075-32420097 ACACAGCATTTTAAATCCTATGG - Intergenic
975173722 4:71262602-71262624 CCACTTCCTTTGAATTCCTAAGG + Intronic
979464433 4:121020422-121020444 TCACTTCAGTTTGAATTCTCTGG - Intergenic
983160376 4:164406277-164406299 CAATTTCTGTTCAAATCCTATGG - Intergenic
986890511 5:12299285-12299307 CCACAGCAGATTAGATCCTAAGG - Intergenic
987705410 5:21457793-21457815 TCACTTGAGTTTAAATAATAAGG - Intergenic
990462873 5:56046093-56046115 CCACTACAGAATAAATCCTGTGG - Intergenic
991458892 5:66835406-66835428 CCACTTCATTGTTAATCTTATGG + Intronic
991512045 5:67389076-67389098 CCACTTTAGTATATATCCAAAGG - Intergenic
992300432 5:75373074-75373096 GCATTTCAGTTTAAATCATGTGG + Exonic
993283307 5:85957265-85957287 CCACTTCAGTTGACTTTCTAAGG + Intergenic
994287451 5:97986672-97986694 TCTCTTCAGTTTAAATGCAAGGG + Intergenic
994776204 5:104038005-104038027 TTACTTCTGATTAAATCCTATGG - Intergenic
998810411 5:145960653-145960675 TCACTTGTGTTTAACTCCTATGG + Intronic
999315007 5:150577885-150577907 CTATTTCAGTTCAAATCCAAAGG + Intergenic
1006129649 6:31861686-31861708 CCAGTACAATTTAAATCCTGAGG + Intronic
1008130496 6:47715271-47715293 CCACTTCCTTTTACATCTTAGGG + Intronic
1009953494 6:70423625-70423647 TCACTTCAGTTTACATTCCATGG + Intronic
1010314599 6:74432601-74432623 CCACTTCAAGTGAAATCATAAGG + Intergenic
1011135499 6:84095549-84095571 CCACCTCAGGTTAAATTCAATGG + Intergenic
1014126020 6:117777950-117777972 CCACTTAATTTAAAATTCTATGG + Intergenic
1015667573 6:135648751-135648773 CCTCTTCTGTGTACATCCTAGGG - Intergenic
1016951074 6:149580781-149580803 CCACTCCATTTTAAATGCTAGGG - Intronic
1017458566 6:154626113-154626135 CCACTTTAATTTAAAGCCTAGGG + Intergenic
1018728385 6:166630891-166630913 CCACTACAGTTTACCTTCTAGGG - Intronic
1019129789 6:169865308-169865330 CCAATTCAGTTCAAATCCGAAGG + Intergenic
1022771919 7:33482684-33482706 CCAGTTCAGTTGAAATTATATGG + Intronic
1024851942 7:53728852-53728874 CCACTGCTGTTTAAATTCAAGGG + Intergenic
1028658652 7:93240407-93240429 ACAATTCAGTATAAATACTATGG - Intronic
1028684585 7:93576944-93576966 CCGCTGGAGGTTAAATCCTAGGG + Intergenic
1030430727 7:109444080-109444102 CAACTTCTGTTTTAATGCTAAGG + Intergenic
1034649467 7:152678121-152678143 TCACTTCAGTTTTAATGCTCCGG + Intergenic
1035777266 8:2197963-2197985 ACACTTCAGTTCAAATCAAAAGG + Intergenic
1036545073 8:9760054-9760076 TAACTTCAGTTTAAAACCAAGGG - Intronic
1038943798 8:32335093-32335115 CCACTTCAGTTTAAATCCTATGG - Intronic
1039720103 8:40154223-40154245 CAACTTCGATTTAAGTCCTAGGG - Exonic
1042637509 8:70894622-70894644 CCACTTCAGCTTAGGTGCTAGGG + Intergenic
1042642206 8:70948953-70948975 AAACTTCAGTTTAAAGCCCATGG - Intergenic
1042827861 8:72996414-72996436 CCCCATCAGTTTAAATCTCAGGG - Intergenic
1050429428 9:5547089-5547111 CCACGTCCTTTTACATCCTATGG - Intronic
1052125415 9:24768710-24768732 CCACTTCAGGTGAAAGCCTCAGG + Intergenic
1052582739 9:30380797-30380819 ACACTTTAGTTTAAATTATATGG + Intergenic
1053142071 9:35688694-35688716 CCACTTGAGTTACAACCCTAAGG - Intronic
1055802632 9:80056875-80056897 CCACCTCAATTTATATTCTAGGG - Intergenic
1057954127 9:99393957-99393979 CCACATCAGTTTGAATGCTTTGG + Intergenic
1059886401 9:118749335-118749357 CCACATCAGCTTAATTCCTGGGG - Intergenic
1060465056 9:123896350-123896372 CCACTTCGGTTTAAATTCTGGGG - Intronic
1189794870 X:44635897-44635919 CCACATCAGTTTAAATTTTGAGG - Intergenic
1189908118 X:45782734-45782756 CCACTGCACTGTAAATCATAAGG - Intergenic
1196330280 X:114464923-114464945 TCACTTCAGTTTTAATCCCTGGG - Intergenic
1199520625 X:148731255-148731277 CCACTTCAGTTTAGGTCCTTTGG - Intronic