ID: 1038946728

View in Genome Browser
Species Human (GRCh38)
Location 8:32369605-32369627
Sequence CCAGGTCTGCCCTTGTTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038946720_1038946728 17 Left 1038946720 8:32369565-32369587 CCCAACCAGGGACCCTGAAGGCA 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1038946728 8:32369605-32369627 CCAGGTCTGCCCTTGTTGGAAGG No data
1038946722_1038946728 12 Left 1038946722 8:32369570-32369592 CCAGGGACCCTGAAGGCATCTCA 0: 1
1: 0
2: 2
3: 21
4: 200
Right 1038946728 8:32369605-32369627 CCAGGTCTGCCCTTGTTGGAAGG No data
1038946717_1038946728 19 Left 1038946717 8:32369563-32369585 CCCCCAACCAGGGACCCTGAAGG 0: 1
1: 0
2: 0
3: 32
4: 206
Right 1038946728 8:32369605-32369627 CCAGGTCTGCCCTTGTTGGAAGG No data
1038946719_1038946728 18 Left 1038946719 8:32369564-32369586 CCCCAACCAGGGACCCTGAAGGC 0: 1
1: 0
2: 1
3: 20
4: 215
Right 1038946728 8:32369605-32369627 CCAGGTCTGCCCTTGTTGGAAGG No data
1038946723_1038946728 5 Left 1038946723 8:32369577-32369599 CCCTGAAGGCATCTCAAGAGAGC 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1038946728 8:32369605-32369627 CCAGGTCTGCCCTTGTTGGAAGG No data
1038946724_1038946728 4 Left 1038946724 8:32369578-32369600 CCTGAAGGCATCTCAAGAGAGCA 0: 1
1: 0
2: 3
3: 10
4: 175
Right 1038946728 8:32369605-32369627 CCAGGTCTGCCCTTGTTGGAAGG No data
1038946721_1038946728 16 Left 1038946721 8:32369566-32369588 CCAACCAGGGACCCTGAAGGCAT 0: 1
1: 0
2: 0
3: 19
4: 143
Right 1038946728 8:32369605-32369627 CCAGGTCTGCCCTTGTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038946728 Original CRISPR CCAGGTCTGCCCTTGTTGGA AGG Intronic
No off target data available for this crispr