ID: 1038948674

View in Genome Browser
Species Human (GRCh38)
Location 8:32390105-32390127
Sequence ATGGGAAAGCAGAGTGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 776
Summary {0: 1, 1: 0, 2: 7, 3: 84, 4: 684}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038948674_1038948676 -10 Left 1038948674 8:32390105-32390127 CCCTCTTCACTCTGCTTTCCCAT 0: 1
1: 0
2: 7
3: 84
4: 684
Right 1038948676 8:32390118-32390140 GCTTTCCCATTCTCTATGCCTGG No data
1038948674_1038948682 23 Left 1038948674 8:32390105-32390127 CCCTCTTCACTCTGCTTTCCCAT 0: 1
1: 0
2: 7
3: 84
4: 684
Right 1038948682 8:32390151-32390173 AAAAGACGCCATGTTCTCCTGGG No data
1038948674_1038948681 22 Left 1038948674 8:32390105-32390127 CCCTCTTCACTCTGCTTTCCCAT 0: 1
1: 0
2: 7
3: 84
4: 684
Right 1038948681 8:32390150-32390172 TAAAAGACGCCATGTTCTCCTGG No data
1038948674_1038948683 24 Left 1038948674 8:32390105-32390127 CCCTCTTCACTCTGCTTTCCCAT 0: 1
1: 0
2: 7
3: 84
4: 684
Right 1038948683 8:32390152-32390174 AAAGACGCCATGTTCTCCTGGGG No data
1038948674_1038948677 -9 Left 1038948674 8:32390105-32390127 CCCTCTTCACTCTGCTTTCCCAT 0: 1
1: 0
2: 7
3: 84
4: 684
Right 1038948677 8:32390119-32390141 CTTTCCCATTCTCTATGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038948674 Original CRISPR ATGGGAAAGCAGAGTGAAGA GGG (reversed) Intronic
900785897 1:4650271-4650293 GTGGGAAATTAGAGAGAAGAGGG - Intergenic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
901372881 1:8815712-8815734 TTGGGAGAGAAGAGAGAAGATGG - Intronic
902194651 1:14789390-14789412 GTGGGGAAGCAGAGGGAAGCAGG - Intronic
903234586 1:21941513-21941535 AAGGGAGAGTAGAGTGAAGGGGG - Intergenic
903583435 1:24389751-24389773 ATGGGAAACCAGACAGAAAATGG + Intronic
903806984 1:26012640-26012662 ATCTGAAAGCAGAGATAAGAGGG + Intergenic
903920554 1:26797174-26797196 ATGGCAAAGCAGAGGGAAATGGG - Intronic
904868964 1:33604639-33604661 ATGGGATGCCAGAATGAAGAGGG + Intronic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905656868 1:39691220-39691242 ATGGGAAGGGAGAGTGGAGGGGG + Intronic
905787480 1:40769891-40769913 AGGGGAAAGCAGAGGGAAAAGGG - Intronic
906273004 1:44496249-44496271 ATGGGAAATCCCAGTGAAGCTGG + Intronic
906294745 1:44642711-44642733 ATGGCAAAGCAGAGAAAACAGGG - Intronic
906537344 1:46558811-46558833 AGGGGAAAGCACAGAAAAGAGGG + Intronic
907454953 1:54569485-54569507 AGGGGAAAACAGAGGGAACAAGG - Intronic
907716800 1:56933625-56933647 AAGGGGAAGCAGAGAGAAGATGG - Intronic
908033431 1:60026477-60026499 AGAGGAAAGAAGAGAGAAGAGGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
909092305 1:71241669-71241691 ATGGGAAAGGAGAGCAAATAGGG + Intergenic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
909956276 1:81782811-81782833 TTGGGAAAGCAGAGCTTAGAAGG + Intronic
910259152 1:85279157-85279179 AGGGGAAAGAAGATGGAAGAGGG + Intergenic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
911234731 1:95399952-95399974 GAGGTCAAGCAGAGTGAAGAGGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911583447 1:99662065-99662087 AAGGAAAAGGGGAGTGAAGAAGG + Intronic
912369633 1:109164131-109164153 ATGTGAAATGAGAGTGATGATGG - Intronic
912753597 1:112305868-112305890 CTGGGAAGGCTGAGAGAAGAAGG + Intergenic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914672854 1:149885143-149885165 ATGTGAAGGCACAGTGAAAATGG - Exonic
916076036 1:161200497-161200519 GTGACAAAGCAGAGTGAATAGGG - Intronic
916117900 1:161503494-161503516 TTGGGTAAGCAGAGTATAGATGG + Intergenic
916755956 1:167770561-167770583 ATAGGAAACCAGAAGGAAGAGGG + Intronic
916785515 1:168084402-168084424 GTGGGAAAACAGAGTGGAGTTGG - Exonic
917959284 1:180129481-180129503 GTGGGAAAGCAGGGAGCAGAAGG + Intergenic
918553942 1:185777198-185777220 ATGAGAATGAAGAGTGTAGATGG + Intronic
918832934 1:189422076-189422098 ATAGGCAAGCAGAATGAAGAAGG - Intergenic
918955512 1:191201705-191201727 ATGCAAAAGCAGTGTTAAGAGGG + Intergenic
918991395 1:191701187-191701209 AGGGCAAAGGAGAGGGAAGAGGG - Intergenic
919436017 1:197562098-197562120 ATGGGAAAGTAGATAGAACAGGG - Intronic
920912166 1:210229164-210229186 TTGGGAAAGCAGAGATAATAGGG + Intergenic
921049120 1:211498620-211498642 ATGGGAAATCAATGGGAAGAGGG + Intergenic
921230736 1:213067646-213067668 AGGGGAGTGCAGAGTGAAGGAGG - Intronic
921419753 1:214932714-214932736 ATGTGAAAGCACATTGAGGAAGG + Intergenic
921648911 1:217653313-217653335 ATAGGAAAGAAAATTGAAGAGGG + Intronic
921981723 1:221265930-221265952 TTGGGAATGCAGAGTGACTAAGG + Intergenic
922150187 1:222995185-222995207 ATGGGAAAGAAAAAGGAAGATGG - Intronic
922467246 1:225852844-225852866 ATGGGAGAGCAGGGTGGAGGAGG + Intronic
923534496 1:234838321-234838343 AGGGGAAAGAAGAAGGAAGAAGG + Intergenic
923841826 1:237681046-237681068 ATGAGAAAGCATTGTTAAGAGGG - Intronic
924189764 1:241538278-241538300 ATGAGAAAGCAGATAGAAGAAGG - Intronic
924261365 1:242234800-242234822 ATGGGAAGGCAGAGTGCAGTAGG + Intronic
1063006317 10:1974381-1974403 ACAGGAAAGCAAAGTGATGAAGG - Intergenic
1063120595 10:3103076-3103098 ATGAGAAATCAGTGTGAAGATGG + Intronic
1063866131 10:10367314-10367336 GTGGGGAAGCGGAGGGAAGAGGG - Intergenic
1064597683 10:16962108-16962130 ATGAGAAAGCAAAGAGAAGGGGG - Intronic
1064709312 10:18107474-18107496 ATGCAAGAGCAGACTGAAGAGGG - Intergenic
1064909690 10:20386327-20386349 ATGAGAAAGCCAAGTGAAGCAGG + Intergenic
1066021475 10:31307979-31308001 ATGGGAAAACAGATTCAACAAGG + Intergenic
1068253574 10:54476843-54476865 ATAGGAGAGAAGAGTGATGATGG - Intronic
1068281399 10:54875332-54875354 ATGGGGAAGAAGAGAGAAGGAGG - Intronic
1069070675 10:63987934-63987956 ATGGCAGACCAGAGTGAACAGGG - Intergenic
1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG + Intergenic
1069307222 10:66985608-66985630 AGTGGAAAGCAGAATGGAGAAGG + Intronic
1069933794 10:71901196-71901218 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933801 10:71901215-71901237 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069933808 10:71901234-71901256 ATGGGAATGGGGAGGGAAGATGG - Intergenic
1069989170 10:72303939-72303961 ATGGGAGAGCTGAGTGTAGCAGG + Intergenic
1070195522 10:74152647-74152669 ATAGGAAAACACAGTGAAAATGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070576176 10:77680802-77680824 AGGGGAAAGAAGAGTGGAAAAGG - Intergenic
1070723113 10:78770322-78770344 ATGGGAAAGCCACGAGAAGATGG - Intergenic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071689908 10:87806026-87806048 GTGGGAAAGAAGTGAGAAGAGGG + Intronic
1072246176 10:93546093-93546115 ATGTGAAAGCACATTGCAGATGG + Intergenic
1073930474 10:108568265-108568287 GTGGGGCAACAGAGTGAAGAAGG - Intergenic
1074221675 10:111444369-111444391 ATGGAAACCCAGAGTGAAGCTGG + Intergenic
1074365054 10:112851039-112851061 ATGTGAAAGCAGAGTTCGGAAGG - Intergenic
1074495614 10:113977837-113977859 ATGGGAAAGAGGAGTGAGGTGGG - Intergenic
1074707878 10:116151597-116151619 ATGGGAAAATAGAGGGAAGAGGG + Intronic
1075373343 10:121956483-121956505 ATAGGATAGCAGCTTGAAGAGGG + Intergenic
1075658617 10:124177789-124177811 AGGGGAAAGCAGAATGGAGAGGG - Intergenic
1076019695 10:127062449-127062471 GTAGCAATGCAGAGTGAAGACGG - Intronic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076260445 10:129060750-129060772 TTGGGGAAGCAAAGTGAACAAGG - Intergenic
1076588409 10:131566879-131566901 ATGGGAAAGAAAAGAGTAGAAGG + Intergenic
1076694079 10:132238601-132238623 CTGGGAAAGCATAGAGCAGACGG + Intronic
1076811212 10:132887441-132887463 AGGGGAGAGGAGAGAGAAGAGGG - Intronic
1077096794 11:802388-802410 ACAGGAAAGCTGAGTGAGGAAGG + Exonic
1077809964 11:5627065-5627087 AGATGAGAGCAGAGTGAAGAAGG + Intronic
1078203706 11:9209322-9209344 ATAGGAAAGCTGAGTGATTAAGG + Intronic
1078630361 11:12997618-12997640 ATGCGAAAGGAGAGGGAAAAAGG + Intergenic
1078829076 11:14961771-14961793 GTGGAAAAGCAGTGTGTAGAGGG + Intronic
1079427799 11:20360194-20360216 AGGGGAAAGCATAGGGAAGGAGG - Intergenic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1079955452 11:26857535-26857557 ATGGTAAAGTAGAGTGAAAAAGG + Intergenic
1080015662 11:27504195-27504217 ATGGGAAATCAGAATGGTGAAGG - Intronic
1080749823 11:35141415-35141437 ATGGGAGAGAAGAGTCAAGCTGG + Intronic
1081235509 11:40643024-40643046 CTTGAAAAGTAGAGTGAAGAAGG + Intronic
1081630843 11:44688558-44688580 GCGGGAAACCAGAGGGAAGAAGG + Intergenic
1082090757 11:48087838-48087860 AGGGGAAGGCAGGGAGAAGAAGG - Intronic
1082142957 11:48631023-48631045 AGTGGAAAGCAGAGTGTAAAAGG - Intergenic
1082143681 11:48641034-48641056 AAAGGAAAGGAGAGGGAAGAAGG - Intergenic
1082570157 11:54728387-54728409 AGTGGAAAGCAGAGTGCAAAAGG - Intergenic
1083380463 11:62264229-62264251 ATGAGACAGAAGACTGAAGAAGG + Intergenic
1084187966 11:67485098-67485120 GTGGCAGAGCAGAGTGAAGGAGG - Intronic
1085056299 11:73406078-73406100 GTGGGGAAGGAGAGGGAAGAAGG - Exonic
1085091421 11:73718179-73718201 AGGGGAAAGCAGAGAAAAGCTGG + Intronic
1085104335 11:73829269-73829291 GTGAGAAAGCAGGGTGAGGAGGG + Intronic
1085129496 11:74025967-74025989 AAGGGAAAGCACAGAGAGGAAGG + Intronic
1085202099 11:74708062-74708084 AGGGAAAGGCAGAGTGAAGAAGG - Intronic
1086696979 11:89858904-89858926 AGGGGAAGCCAGAGAGAAGAGGG + Intergenic
1086709179 11:89985583-89985605 AGGGGAAGCCAGAGAGAAGAGGG - Intergenic
1088066368 11:105725588-105725610 ATTGGAAAGCAGGGGCAAGATGG + Intronic
1088182322 11:107126828-107126850 AGGGGGAAGGAGAGTGAAGCTGG - Intergenic
1088226842 11:107629895-107629917 AAGGGAAAGCAGAGGGAAAGAGG + Intronic
1088432094 11:109769817-109769839 AGGGGAAAGAAGAGGTAAGAGGG - Intergenic
1088435905 11:109812852-109812874 AGGGGAAAAAAGAGTGAGGAGGG - Intergenic
1088469050 11:110174966-110174988 ACATGAAAGCAGAGTGATGAAGG - Intronic
1088760792 11:112927108-112927130 ATGGGATATCAGAGTGAAAAAGG - Intergenic
1088767187 11:112994070-112994092 ATGGCAAAGCAGAAAGAAAAAGG - Intronic
1089103296 11:115982152-115982174 GTGGGAGAGCAAAGTGAGGATGG - Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089367222 11:117928306-117928328 CTGGGAAAGAAAAGTCAAGAGGG + Intronic
1089876806 11:121730255-121730277 AGGGGAGGGCAAAGTGAAGAAGG - Intergenic
1089942494 11:122433434-122433456 ATGGGAATACAGAGAGAAGAGGG + Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090338446 11:125992511-125992533 ATGGGAAAGCAGAGCCTGGAAGG - Intronic
1090640225 11:128723569-128723591 ATGGGAAAGAAAGGGGAAGAAGG + Intronic
1091145907 11:133280071-133280093 TTGGGAGTGCAGAGTGAAGATGG + Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1092296512 12:7203401-7203423 AAGGGAAAGCAGATAGAAAAAGG - Intronic
1092403274 12:8196068-8196090 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1092736783 12:11590266-11590288 ATGGGAGAGAAGAATGAGGATGG + Intergenic
1094138188 12:27151595-27151617 ATGGTGAAGCAGAGTTAATAGGG + Intergenic
1094311179 12:29085686-29085708 AGGGGCAAGCAGAGGGAATATGG + Intergenic
1094323672 12:29213058-29213080 ATGGGAAGGAAGTTTGAAGAAGG - Intronic
1094450425 12:30577963-30577985 AGGGAAATGCAGAGTGTAGAGGG + Intergenic
1094516155 12:31129067-31129089 AGGGGAAAGGAGATAGAAGATGG + Intergenic
1094769843 12:33642626-33642648 TTGGATAAGCTGAGTGAAGATGG + Intergenic
1095516171 12:43007763-43007785 AGGAGAAAGCAGATTCAAGAAGG - Intergenic
1096518205 12:52169993-52170015 AGGGGAGAGGAGAGTGAAGGAGG + Exonic
1097044974 12:56180914-56180936 TTGGCAAAGGAGAGTCAAGACGG + Intronic
1097284060 12:57864370-57864392 ATGGAAAGGCAGGGTGGAGAAGG - Intergenic
1098976494 12:76907744-76907766 ATGGCAAAGGAGAATTAAGATGG + Intergenic
1099156332 12:79180991-79181013 AGGAGAATGCAGAGTGAAGAGGG - Intronic
1099431525 12:82591913-82591935 CTGGGAAAGTAGAGTGGAGTGGG + Intergenic
1099610209 12:84858036-84858058 AAGGGAAAGCACAGTGACTAAGG - Intergenic
1099701381 12:86086804-86086826 ATGGGAGAGGAGGGTAAAGAGGG - Intronic
1099880447 12:88461010-88461032 AGGGGAGAGCCAAGTGAAGATGG - Intergenic
1100277914 12:93088496-93088518 ATGGGAAAGTTGAGTGAAGCAGG - Intergenic
1100289682 12:93201933-93201955 ATGTGAAAGCAGTCTTAAGAAGG - Intergenic
1100405651 12:94270888-94270910 AAAGGGGAGCAGAGTGAAGAGGG + Intronic
1101814084 12:108131736-108131758 ATGAGAAAGCAGAGAGAGGGCGG - Exonic
1101835862 12:108295071-108295093 ACTGGAATGCAGAGAGAAGATGG + Intronic
1102057532 12:109907852-109907874 ATGGGAAAGCACAAGGCAGATGG - Intronic
1102308169 12:111822601-111822623 ATGGGATATCAGAGTGGAAAAGG - Intergenic
1102698120 12:114815677-114815699 ATGGAAAAACAGAGCTAAGAAGG - Intergenic
1103451319 12:121031397-121031419 AGGGGCAAGGAGAGGGAAGAGGG - Intronic
1103851016 12:123933759-123933781 ATGAGCTAGCAGAGTGAACATGG - Intronic
1104066854 12:125313611-125313633 AGGGGAAAGGAGAGGGGAGAGGG - Intronic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104707402 12:130957795-130957817 GTGGAAAAGCACAGTGAAGGCGG + Intronic
1104996591 12:132661685-132661707 CTGAGAAACAAGAGTGAAGAGGG + Intronic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1106245721 13:27948307-27948329 ATGAGAAAGCAATGTGAAGAAGG - Intergenic
1106281775 13:28280153-28280175 ATGAGAAAGAAAAGTGAAGTAGG - Intronic
1106953245 13:34907715-34907737 AGGGGAATACAGAGGGAAGAAGG - Intergenic
1107222102 13:37995161-37995183 AAGGAAAAGCTGAGTGGAGAAGG - Intergenic
1108050772 13:46435986-46436008 ATGGGAGAGCAAATTGAATAAGG - Intronic
1108292062 13:48971902-48971924 ATGGGACAGCAGATTGAGGTGGG - Intergenic
1108348299 13:49567235-49567257 AGGGGAGAGTAGAGTGAAGATGG + Exonic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1109543346 13:63809611-63809633 ATGGGAGAGCAAATTGAATAAGG - Intergenic
1110080267 13:71300741-71300763 ATGGGATAGCAGAGAGAAGAAGG - Intergenic
1110111202 13:71748213-71748235 GGGGGAAAGCAAAGTGAAGCAGG + Intronic
1110357426 13:74584139-74584161 CTGGGAATACAGAGTGAAGCGGG + Intergenic
1110511599 13:76356929-76356951 ATGGGTATGCAGTGTGAAAATGG + Intergenic
1110659252 13:78039556-78039578 AGGGGAAAGGAGAGTAGAGATGG + Intergenic
1110694685 13:78474311-78474333 AAGGAAAAGAAGAGTGAAAATGG + Intergenic
1111293891 13:86255599-86255621 ATGGGAAAGTAGAGAGAGGAAGG - Intergenic
1111447079 13:88360848-88360870 ACAGGAGAGCAGAGTGAGGAGGG - Intergenic
1111477482 13:88771495-88771517 GGGGGAAAGGAGAGTGAAGGGGG - Intergenic
1111741147 13:92207179-92207201 ATGGGAAAGGAAAGAGAGGAGGG - Intronic
1112483194 13:99796005-99796027 AGGGGAAAGCAAAGTAGAGAGGG + Intronic
1112667327 13:101590576-101590598 ATTGAAAACCAGATTGAAGAGGG - Intronic
1112748342 13:102553073-102553095 ATGGTCCAGCAGAGAGAAGACGG - Intergenic
1113116965 13:106884764-106884786 ATGGGTAATGAGAGTGAAGTCGG - Intergenic
1113167492 13:107458561-107458583 ATGGGAAACGAGAGAGAAGCAGG + Intronic
1113201738 13:107874030-107874052 CAGGGAAAGCAGAGTGGACAGGG + Intergenic
1113253043 13:108475615-108475637 AGGGGAAAGCAGAATCAAAACGG + Intergenic
1114039852 14:18667757-18667779 TTGGGAAAGGAGAGCAAAGATGG - Intergenic
1114044893 14:18866306-18866328 TTGGGAAAGGAGAGCAAAGATGG - Intergenic
1114119330 14:19653216-19653238 TTGGGAAAGGAGAGCAAAGATGG + Intergenic
1114558678 14:23576633-23576655 GTGGGAGAGCAGAGTGAAGACGG + Intronic
1115081176 14:29452144-29452166 ATGGGAAAGCTTGGTAAAGACGG + Intergenic
1115352156 14:32407148-32407170 ATGGGAAAGGAAAGCCAAGATGG - Intronic
1115434437 14:33357165-33357187 ATGTGAAATTAGAGGGAAGATGG + Intronic
1116371559 14:44140529-44140551 ATGAGAGAGGAGAGTGGAGAAGG + Intergenic
1117200694 14:53386948-53386970 AAGTGAAAGAAGACTGAAGAAGG - Intergenic
1117406594 14:55410139-55410161 ATGGGAAAACAGATTTATGATGG + Intronic
1117473900 14:56074319-56074341 CTGGGACAGCAGGGTGAAGGAGG - Intergenic
1117936707 14:60914848-60914870 TTGGGAGAGCAGAGTGAACATGG + Intronic
1119330829 14:73792308-73792330 AAGGGTAAGGAGAGAGAAGAGGG + Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121574463 14:94972197-94972219 GTGAGAATGCAGAGGGAAGAAGG + Intergenic
1121737555 14:96228937-96228959 ATGGGAAAGCAGAGTCAGCGAGG - Intronic
1121796917 14:96742866-96742888 ATGGGATACCAGAGTCCAGAAGG + Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122767400 14:104081802-104081824 ATGGGAAGTGAGAGAGAAGAGGG + Intergenic
1124101514 15:26698612-26698634 ATGATAAAACAGAATGAAGAGGG + Intronic
1124487090 15:30127962-30127984 ATGGCACAGCAGAGTTAACAAGG + Intergenic
1124542175 15:30596937-30596959 ATGGCACAGCAGAGTTAACAAGG + Intergenic
1124548877 15:30659042-30659064 ATGGCACAGCAGAGTTAACAAGG + Intronic
1124608756 15:31193266-31193288 GAGGGAAAGCAGATGGAAGAGGG - Intergenic
1124756436 15:32410361-32410383 ATGGCACAGCAGAGTTAACAAGG - Intergenic
1125104651 15:35956325-35956347 ATTGGAAAGCAGAGTGTAGTTGG - Intergenic
1125491226 15:40150047-40150069 AAGGGAAAGGAGAGTGGAAAGGG - Intergenic
1126023618 15:44426009-44426031 ATGGGAGGGCAGGGGGAAGATGG - Intergenic
1126262333 15:46708428-46708450 ATTTGTAAGCAGAATGAAGATGG - Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126687301 15:51259557-51259579 AGGGGAAGGGAGGGTGAAGATGG + Intronic
1127788648 15:62378748-62378770 GTGGGAAAGGAGAGGAAAGAAGG + Intergenic
1128305243 15:66594020-66594042 GTCTGAAAGCAGAGTGAGGATGG + Intronic
1128453937 15:67822477-67822499 AGGGGAAAGAATGGTGAAGACGG + Intronic
1128855212 15:71005167-71005189 TTGGGAAAACAGAATGAAGAAGG - Intronic
1128926713 15:71662934-71662956 AAGGGAAGGCAGAGGGAAAATGG + Intronic
1129061178 15:72861466-72861488 CTTGGAAAGCTGAGTAAAGATGG - Intergenic
1129760325 15:78125433-78125455 ATGGGATAGGAGAGAGAAGAGGG - Intronic
1129991724 15:79970875-79970897 ATGGAAAAGGAGTTTGAAGACGG - Exonic
1130123739 15:81074607-81074629 ATGTGAAAGCAAAGTGAGCATGG + Intronic
1130520774 15:84659004-84659026 ATGGGAATGCAGAATGATGGAGG + Intergenic
1130794336 15:87193036-87193058 GGTGGAAAGCAGAGAGAAGAAGG + Intergenic
1130846221 15:87748711-87748733 AGATGAGAGCAGAGTGAAGACGG + Intergenic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131603282 15:93872201-93872223 GTGAGAGAGCAGAGAGAAGAGGG - Intergenic
1131703338 15:94964738-94964760 ATTGCAAAGTAGAGTGATGAAGG + Intergenic
1132412934 15:101598618-101598640 ATTGTAAATCAGAGTTAAGAAGG - Intergenic
1133048222 16:3100957-3100979 ATGGGACAGCAGTCTGAAGTAGG + Intergenic
1133647247 16:7775856-7775878 AGGGGAGAGCAGGGGGAAGAGGG + Intergenic
1134634259 16:15780061-15780083 CTTGGGAAGGAGAGTGAAGAAGG - Intronic
1135124854 16:19800134-19800156 ATGGGAAAGTAGAGAGAGGAAGG + Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1136054498 16:27678412-27678434 AGGGAAAAGGAGAGGGAAGAGGG - Intronic
1137512567 16:49114590-49114612 ATGGGAAAGGAAAGTGGAGGAGG - Intergenic
1137779904 16:51089197-51089219 ATGGGAATGGAGAGAGAAGGAGG - Intergenic
1137794845 16:51207318-51207340 ATGGGAAAGGACATTGTAGATGG - Intergenic
1137824935 16:51484809-51484831 ATGGGAAAACAGAGAGAGAAAGG - Intergenic
1138063600 16:53917112-53917134 ATGGGGTAGCAGAGTAAGGATGG - Intronic
1140088395 16:71816782-71816804 CCGAGAAAGGAGAGTGAAGAGGG + Intergenic
1140246224 16:73252484-73252506 ATAGGAAAGCTGGGAGAAGAAGG + Intergenic
1140558788 16:75953311-75953333 ATGGGATAGCAAAGAGAAAATGG + Intergenic
1140737695 16:77912867-77912889 ATGAGGAAGCAGTGAGAAGACGG - Intronic
1140767164 16:78170819-78170841 TTGAGAAAGCAGAGAGATGAGGG + Intronic
1141414405 16:83859013-83859035 AGGGGAAAGCAGAGTGAGTCAGG + Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143133175 17:4693853-4693875 AAGGGAAAGCACAGATAAGAGGG + Intronic
1143408062 17:6691086-6691108 AGGAGACAGCAGAGTGAGGACGG - Intronic
1143413646 17:6728847-6728869 AGGAGAAAGAAGAGTAAAGAGGG + Intergenic
1144160586 17:12553774-12553796 GTGAGAATGCAGTGTGAAGATGG - Intergenic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1146525809 17:33566076-33566098 AAGGGAGAGCTGAGTGAGGAGGG - Intronic
1147355380 17:39891854-39891876 ACTGGAAAGGAGAGAGAAGAAGG + Intergenic
1147367491 17:39968702-39968724 AAGGGCAAGAGGAGTGAAGAGGG + Intronic
1147532891 17:41296697-41296719 AAGGGAAATAAGACTGAAGAGGG + Intergenic
1149183827 17:53973763-53973785 ATGGAAAAGGAGAGAGAAGAGGG - Intergenic
1149247211 17:54723837-54723859 ATCACAAAGCACAGTGAAGAAGG + Intergenic
1149434091 17:56618724-56618746 GTGGGAGAGCAGAGTGAGCATGG + Intergenic
1150200394 17:63350296-63350318 GGGGGAAAGCAGAGGGAAGAGGG - Intronic
1150434726 17:65144966-65144988 ATGTGAGAACAGAGAGAAGACGG - Intronic
1151311272 17:73293762-73293784 ATAGGAAAGCACAGGGAAGGCGG + Intronic
1151329238 17:73397118-73397140 CTGGGGAAGCAGGGTCAAGAGGG + Intronic
1151889279 17:76942677-76942699 ATAGGAAAGAAGAGTGAAGGGGG + Intronic
1152562453 17:81085372-81085394 ATGGGACAGCAGAGGAAGGAGGG + Intronic
1153588791 18:6651417-6651439 AGGGGAAAGGAGAGTGAGGAAGG - Intergenic
1153705356 18:7739556-7739578 ATGGGAAAGCAAAAGGAAAATGG - Intronic
1153728281 18:7980328-7980350 AGGGGGCAGCAGAGTGAACATGG - Intronic
1154059572 18:11047070-11047092 ATGGAAAGGATGAGTGAAGACGG - Intronic
1154229532 18:12542477-12542499 ATGGGAAAACAAATAGAAGATGG - Intronic
1155181913 18:23355360-23355382 ATGGGCAAGCAGGGTGTAGAGGG - Intronic
1155523800 18:26696239-26696261 ATTGGGAAGCTGAGGGAAGATGG + Intergenic
1155752765 18:29449426-29449448 ATAGGGAGGCTGAGTGAAGATGG - Intergenic
1156111726 18:33735668-33735690 AGGCAAAAGCAGAGGGAAGAAGG - Intronic
1156408924 18:36809102-36809124 ATGGGAAAGCATCATGTAGAAGG + Intronic
1156697485 18:39784378-39784400 ATGGGGTAGGAGAGTGGAGATGG - Intergenic
1157465369 18:47939715-47939737 GTGGGACAGCAGAGTTAACAAGG + Intergenic
1158133179 18:54175598-54175620 AGGGGGAAGCAGTGTGAATAAGG - Intronic
1158317943 18:56232175-56232197 AAGGAAAAGAAGAGAGAAGAAGG + Intergenic
1158632859 18:59131570-59131592 ATCACAAAGCAGAATGAAGAAGG + Intergenic
1158718821 18:59905145-59905167 ATGGGAAACGTGAGGGAAGAAGG + Intergenic
1158794508 18:60827019-60827041 TTGGGGTAGCAGAGTGGAGAGGG + Intergenic
1160456093 18:79001754-79001776 ATGGGAAAGCAGATTTTACATGG - Intronic
1161821153 19:6531867-6531889 TTGGGAATGCGGAATGAAGAGGG - Intronic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162163243 19:8734616-8734638 AAGAGAAAGCAGATTGATGATGG + Intergenic
1162404003 19:10462643-10462665 ATGGGATTGGAAAGTGAAGATGG - Intronic
1162470608 19:10870618-10870640 AGGGGGATGCAGAGAGAAGACGG + Intergenic
1162595209 19:11623336-11623358 ATGGGATATCAGAGTGAAAAAGG - Intergenic
1162616612 19:11806317-11806339 ATGGTAACGCACAGTGGAGATGG + Exonic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164035592 19:21451332-21451354 GTGGGAAAGCAGAGTTACCAGGG - Intronic
1164249743 19:23466353-23466375 AGGGGAAAGAGGAGAGAAGAAGG - Intergenic
1164866846 19:31611510-31611532 AAGGGAAAGGAGAGAGAGGAGGG + Intergenic
1165425379 19:35742629-35742651 ATGGGGCAGGAGAGTGAAGGGGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166239282 19:41478794-41478816 ATCGGGAAGCAGAGTGACAATGG - Intergenic
1166569642 19:43785301-43785323 CTGGTGAAGGAGAGTGAAGAGGG + Intergenic
1167442173 19:49514619-49514641 ATGGGAGGGCTGAGTGTAGAAGG - Intronic
1167639369 19:50672233-50672255 AAGGGAGAGCAGTGTGAAGACGG + Intronic
1168333285 19:55581656-55581678 ATGGGAATGCAGAGAACAGAAGG + Intergenic
1168351318 19:55677768-55677790 ATGGGAAAGAAGGCTGATGAAGG - Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925944262 2:8846243-8846265 AAGGGAAAGCAGAGTGACATGGG + Intergenic
926226853 2:10972955-10972977 ATGGGAGAGGGGAGTGCAGAGGG + Intergenic
927013585 2:18932153-18932175 ATTGAAAAGCAGAGAAAAGAAGG - Intergenic
927240588 2:20916789-20916811 ATGGGAAAGCCCTGTGGAGAAGG - Intergenic
927287947 2:21376601-21376623 AGAGGAAAGGAGAGTGAAGGGGG - Intergenic
927291014 2:21405088-21405110 TTGGGAATGGAGAATGAAGAGGG + Intergenic
927323004 2:21770333-21770355 TTGGTATAGTAGAGTGAAGAAGG - Intergenic
928696030 2:33851179-33851201 ATGGAAAAACTGATTGAAGAAGG + Intergenic
929774949 2:44923966-44923988 ATGGCAGAACAGTGTGAAGAGGG - Intergenic
929808626 2:45169792-45169814 GTGGGAAAGCAGAGAGAAGGAGG - Intergenic
929841099 2:45464182-45464204 ATGGCTAAGGAAAGTGAAGAAGG - Intronic
930622738 2:53661004-53661026 ATAGGAAAGCAGTGAGGAGAAGG + Intronic
930639484 2:53840527-53840549 AAAGGAAAGGAGAGAGAAGAGGG + Intergenic
930975001 2:57446791-57446813 GAGGGAAAGCAGAGGAAAGAGGG + Intergenic
931049168 2:58390691-58390713 CAGGGAAAGCAGAGTTAGGAAGG - Intergenic
931072246 2:58665907-58665929 AATGGATAGCAGAGTAAAGAAGG + Intergenic
931391343 2:61846621-61846643 ATTGCAAAGCAGAGTCGAGAAGG - Intronic
931625164 2:64250719-64250741 ATGGGAAAGCCGGGGGAGGAAGG + Intergenic
932143888 2:69302263-69302285 ATGGCAAAGCAGAATACAGAAGG + Intergenic
932397643 2:71459094-71459116 ATGTGAAGGGAGAGGGAAGAAGG + Intronic
932785614 2:74599514-74599536 ATGGCAGAGCAGTGTGAAAAGGG - Intronic
933036825 2:77410551-77410573 ATGGGAAAGTACATTGAGGATGG + Intronic
933172355 2:79138079-79138101 ATAGGAAAACACAGGGAAGAGGG + Intergenic
933998168 2:87685169-87685191 ATAGGAAAGCAGAAGGAAGAAGG + Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934458595 2:94196961-94196983 GTGGGAGAGAAGATTGAAGAGGG + Intergenic
934792149 2:97070478-97070500 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
934814473 2:97313231-97313253 GTAGGAAAGCAGAAGGAAGAAGG + Intergenic
934823220 2:97395252-97395274 GTAGGAAAGCAGAAGGAAGAAGG - Intergenic
934982280 2:98852927-98852949 AGGGAAAAGGAGAGAGAAGAAGG + Intronic
936295684 2:111265704-111265726 ATAGGAAAGCAGAAGGAAGAAGG - Intergenic
936805067 2:116321406-116321428 CTGGGAAAGGAGGGTGGAGAAGG + Intergenic
937514465 2:122637864-122637886 ATGGGGCAGTGGAGTGAAGAGGG + Intergenic
937832034 2:126434667-126434689 AGAGGAGAGGAGAGTGAAGAAGG + Intergenic
938270697 2:129967843-129967865 TTGGGAAAGGAGAGCAAAGATGG + Intergenic
939552633 2:143634661-143634683 ATATTAAAGCAGAATGAAGATGG - Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939577545 2:143914585-143914607 CTTGGAAAGCAGTATGAAGATGG + Intergenic
939620694 2:144415419-144415441 ATGGGAAAGCAAAATGAACCGGG - Intronic
939712188 2:145536326-145536348 ATCAGAAAGCAGAATGTAGAAGG - Intergenic
939989560 2:148864611-148864633 ATGGGAGAGAAGAGTGATGTGGG + Intergenic
940436086 2:153656944-153656966 ATGGGAAAGAAAAATTAAGAAGG + Intergenic
940491021 2:154360926-154360948 ATGGGGAAGGGGAGTGAAGATGG + Intronic
940629634 2:156221414-156221436 AAGGGAAGCCAGAGAGAAGAAGG + Intergenic
941483865 2:166053816-166053838 AAGTGAAAGTAGAGTGTAGAAGG - Intronic
941872936 2:170404665-170404687 ATAGGAAAGAAGAGAGAGGAAGG - Intronic
942430875 2:175910131-175910153 ATGGGAAAGTATAGTGAAGAGGG - Intergenic
942929492 2:181472794-181472816 AGGGGAAAACAGAGGGAAGATGG - Intronic
943236853 2:185332753-185332775 GTGGAAAAGTAGACTGAAGAAGG + Intergenic
943496726 2:188629761-188629783 TTAGGAAAGCAGAGTGTAGATGG + Intergenic
943612291 2:190047286-190047308 ATGGGAAAGAAGAAGGAAGAAGG - Intronic
943986942 2:194635109-194635131 ATGGTAAAAAAGATTGAAGATGG - Intergenic
944489921 2:200247995-200248017 GTGGGAGAGCAGTGTGAAGCTGG + Intergenic
945065488 2:205944538-205944560 ATGGGAAAGAAGAGAAAATATGG + Intergenic
945968149 2:216210104-216210126 AGAGGAAAGCAGAAGGAAGATGG + Intergenic
946326871 2:218989159-218989181 AGGGAAAGGAAGAGTGAAGAGGG + Intergenic
946544718 2:220726033-220726055 ATAGCAAAGCAGTGTGGAGAGGG + Intergenic
946748026 2:222864706-222864728 ATGGGAAGGCTCAGTGGAGAGGG + Intronic
946750626 2:222892522-222892544 ATAGGAAACCAGGGTCAAGAAGG - Intronic
947220515 2:227787492-227787514 ATAGGAAAGAAGAGTAATGATGG - Intergenic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947491495 2:230599289-230599311 TTGAGAAAGAAGAATGAAGATGG + Intergenic
947551768 2:231051451-231051473 ATGGGAGGTCAGAGGGAAGAAGG + Intergenic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
948081755 2:235212227-235212249 ACAGGAAAGCAAACTGAAGAAGG - Intergenic
948684604 2:239662523-239662545 ATGGAGGAGCAGAGTGGAGAGGG - Intergenic
948743032 2:240060661-240060683 ATGGAAAAACTGATTGAAGAAGG - Intergenic
1169254041 20:4083711-4083733 ATCTGAAAGCAGAGAGAAGAAGG - Intergenic
1169489857 20:6062224-6062246 ATTGGAAAGGAGAGTGGAGATGG + Intergenic
1169566579 20:6860109-6860131 TTGGGAAAGCAAAGTACAGATGG + Intergenic
1169577852 20:6985883-6985905 ATGCTAAAGCAGTGTCAAGAGGG + Intergenic
1170346191 20:15389341-15389363 AGGAGAAGGAAGAGTGAAGAAGG + Intronic
1170357433 20:15507747-15507769 ATGCTAAAGCAGGGTGAAGCTGG - Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1171793738 20:29550630-29550652 CTGGGAATCCAGGGTGAAGAAGG - Intergenic
1172063977 20:32206888-32206910 ATGGGAAGGAAGAGCGAGGATGG + Intronic
1172408002 20:34703829-34703851 GTGGGAAAGCAGAGTGTGTAAGG + Intronic
1172427655 20:34866198-34866220 TTGGGAAAGGATACTGAAGATGG + Intronic
1173089354 20:39955518-39955540 TGGGGAGAGCAGAGTGAACAAGG - Intergenic
1173104314 20:40118719-40118741 ATGGGAGAGAAAAGTCAAGAAGG + Intergenic
1173201653 20:40959468-40959490 ATGGGAAAGGAGGGTCAAGAAGG + Intergenic
1174090201 20:48040542-48040564 CTGGGAAATCAGAGAGGAGACGG + Intergenic
1174274897 20:49396587-49396609 GAGGGAAAGAAGAGTCAAGATGG + Intronic
1174284894 20:49465514-49465536 ATGGAAACTCAGAGAGAAGAAGG + Intronic
1174753397 20:53134824-53134846 GTGGGATAGCAGAGTGTAGTGGG - Intronic
1175623771 20:60473374-60473396 ATGGGGAGGGAGAGTGAAGGAGG - Intergenic
1175713784 20:61242020-61242042 AGGGGACAGCACAGTGATGAGGG + Intergenic
1177861534 21:26460237-26460259 AAGAAAAAGGAGAGTGAAGATGG - Intergenic
1177917503 21:27108190-27108212 ATGGGAAAGGATGGTGAAGAAGG + Intergenic
1178225369 21:30710928-30710950 AAGGGAAAGGAGAGGCAAGAAGG + Intergenic
1178357102 21:31918656-31918678 AGAAGAAAGCAAAGTGAAGACGG - Intronic
1178455691 21:32748139-32748161 ATGGGAAAGCACAATGAGGCAGG - Intronic
1178476055 21:32938321-32938343 AGGAGAAAGCCGTGTGAAGATGG - Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178862503 21:36300907-36300929 ATGGACAAGCCTAGTGAAGACGG - Intergenic
1179431942 21:41327495-41327517 ATGGGAATGCAAGGTGAATAAGG - Intronic
1180463416 22:15588866-15588888 TTGGGAAAGGAGAGCAAAGATGG - Intergenic
1182922530 22:34093218-34093240 ATGGGAACGCAGGGAGAAGATGG + Intergenic
1182942003 22:34285856-34285878 AGGGGTAAAGAGAGTGAAGAAGG - Intergenic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183456197 22:37924633-37924655 ATGGGAAAGGAGAGTGAGCCAGG - Intronic
1184110347 22:42390432-42390454 ATGGGACAGGAAAGGGAAGAGGG + Intronic
1184331947 22:43833056-43833078 ATGGGAAAGAGGAGAGACGATGG - Intronic
1184712351 22:46259744-46259766 AATGAAAAGCACAGTGAAGAGGG + Exonic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
1185411453 22:50685106-50685128 ATGGGAAAGCAGAATGGGGCTGG + Intergenic
949343887 3:3058717-3058739 ATGGGAGAGAAGGGTGGAGAAGG - Intergenic
949345722 3:3074865-3074887 ATCTGAAAACAGAGTAAAGAAGG + Exonic
949381333 3:3448802-3448824 ATCAGAAAGCAGAGAGAAAATGG - Intergenic
949548089 3:5089763-5089785 ATGGGAAATGAGAGGGAAGGGGG + Intergenic
949573775 3:5319137-5319159 ATGGGCTAGGATAGTGAAGATGG + Intergenic
950043206 3:9933382-9933404 TTGGGAGGGCAGTGTGAAGACGG - Exonic
950077813 3:10199676-10199698 GTGGGAAAGGAGAGTAGAGATGG - Intronic
950623592 3:14227445-14227467 ATGGGATATCAGAGTGGAAAAGG + Intergenic
950744728 3:15078206-15078228 ATTGGACAGCATAGTGTAGAAGG + Intronic
950896852 3:16460483-16460505 CTGGGCAAGCAAAGTGAAGTGGG + Intronic
952654698 3:35771173-35771195 ATGGGAAGTCAGAGTGTTGATGG + Intronic
952707453 3:36393668-36393690 GAGGGAGAGCAGAGAGAAGAAGG - Intronic
953182975 3:40613704-40613726 AAGAGAAAGCAGAGTCTAGAAGG + Intergenic
953311416 3:41883654-41883676 ATGGCACAGCAGAGTTAACAAGG - Intronic
953416186 3:42719227-42719249 AAGGGAAAGCTGAGAGCAGATGG + Intronic
953438243 3:42896822-42896844 ATGGCAGACCAGAGTGAATAGGG - Intronic
953835107 3:46335914-46335936 ACGGGATATCAGAGTGAAAAAGG + Intergenic
954090438 3:48279697-48279719 ATGGGAAAGGAGGGTTAACAAGG - Intronic
954623164 3:52007144-52007166 ATGGGAAAACAGACTGCAGTTGG - Intergenic
954792596 3:53144234-53144256 CTGGGACAGCAGAATGGAGAAGG - Intergenic
954948927 3:54451771-54451793 ATTTGAAAGCAAAGTGCAGAAGG - Intronic
954970484 3:54647614-54647636 AAGGGAAAGCAGAAGGAAGTTGG + Intronic
955237124 3:57149383-57149405 ATGGGTAAGTACAGAGAAGAAGG - Intronic
955472775 3:59303257-59303279 ATGGGGAAGCAGAGGCTAGAAGG - Intergenic
955952855 3:64259729-64259751 AGGGGAAAGCAATGTGAAGATGG + Intronic
956121230 3:65967833-65967855 AAGGGAAGGAAGAGTGAGGAAGG + Intronic
956697089 3:71927810-71927832 TTGGAGAAGCAAAGTGAAGATGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
959778700 3:110202159-110202181 ATGGGATAGCTGGGTGAAAATGG + Intergenic
959788434 3:110329140-110329162 ATGGGAGAGCTGTGAGAAGAGGG + Intergenic
960189404 3:114685070-114685092 ATGGGAAAACAGAATGATGTAGG - Intronic
960299031 3:115979171-115979193 ATGGGGAAGAAGAGCAAAGAGGG + Intronic
960356812 3:116663814-116663836 ATAGAAATGCAGAGGGAAGAAGG + Intronic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961434925 3:126910334-126910356 ATGGGCAATAAGGGTGAAGAAGG - Intronic
961514633 3:127425019-127425041 ATGGGAGAGGAGAGAGGAGAAGG + Intergenic
961544197 3:127620908-127620930 ATGGGCAAGCTCAGTGAAGGAGG + Intronic
962026074 3:131548933-131548955 AGGGCAAAGCAGAGTCAAGGGGG + Intronic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962707957 3:138063054-138063076 ATGGGAATGCAGAATGGAAATGG + Intronic
962754377 3:138456989-138457011 ATGGGAGAGCAGAGGGAGGGGGG - Intronic
963490639 3:145995728-145995750 AAGGGAAATCAGATTGCAGATGG - Intergenic
963832018 3:150018264-150018286 AAGGCAAAGGAGAGAGAAGAGGG + Intronic
964048221 3:152357610-152357632 TTGGGAAAGTAGAGTGGAGCAGG + Intronic
964366144 3:155952658-155952680 TTGGCAAAGAAGAGGGAAGATGG + Intergenic
964809977 3:160652947-160652969 ATTCAAAAGCAGAGTGAAAATGG + Intergenic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965417105 3:168409761-168409783 ATGGTAAAGCATAGTGTAGTTGG + Intergenic
965748966 3:171956975-171956997 AAGAGAAAGAAGAGTGAAAAGGG + Intergenic
966171713 3:177089263-177089285 TTGGGAAAGTTGAGTGATGAGGG - Intronic
966364325 3:179166553-179166575 ATTACAAAGCAGAGTAAAGAAGG - Intronic
967385776 3:188909432-188909454 ATGGGAAAGCTGAGTTACCAAGG - Intergenic
967766572 3:193286800-193286822 ATGGGTAAGCTTAGTGAGGAAGG + Intronic
968611491 4:1559154-1559176 ATGGGGAAGCAGCGTGAATGTGG + Intergenic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969445482 4:7242631-7242653 TTGGGAAAGCAGGATGAATAGGG - Intronic
969516820 4:7652605-7652627 AGGGGTAAGCAGAGCAAAGAGGG - Intronic
969762792 4:9201792-9201814 ATGGGAGAGCAGATGGCAGAAGG + Intergenic
970765300 4:19541144-19541166 ATGGTAAAGCAGAATTCAGAAGG - Intergenic
970775382 4:19668662-19668684 ATGGTAAAAGAGAGAGAAGAAGG + Intergenic
971062175 4:22984753-22984775 ATGGGAAAGCAAAGCAAAGAGGG - Intergenic
971125349 4:23747737-23747759 AAGGGAAAGCAGAGAAGAGAGGG - Intergenic
971239144 4:24872049-24872071 AAGGAAGAGCAAAGTGAAGAAGG + Intronic
972591533 4:40492746-40492768 ATGGGAGTGCTGAGTGAACAGGG - Intronic
972770620 4:42193877-42193899 TGGGTAAAGCAGAGGGAAGATGG + Intergenic
973530398 4:51831948-51831970 ATGGGAAAGCAGACTGTTGTTGG + Intergenic
973570238 4:52231394-52231416 ATGCAAAAGCACAGTGAAGGTGG + Intergenic
973740028 4:53910696-53910718 AAGGGAAAGCAGAGACAAGGAGG + Intronic
974088863 4:57289642-57289664 GTGGAAACGCAGAGAGAAGATGG + Intergenic
974123400 4:57666559-57666581 ATGGTAAAGCAGAGTCAACCAGG + Intergenic
974154099 4:58047977-58047999 ATGGGAGAGCAGAGTGTGGGAGG - Intergenic
976220638 4:82754381-82754403 ATGGGAAAGCAGAGAGAGGGAGG + Intronic
977370363 4:96126669-96126691 ATGGGAAAGGAGAAAGAAAAGGG + Intergenic
977487216 4:97664880-97664902 AAGGGCAAGCAGAGTGGCGAGGG + Intronic
978744192 4:112173533-112173555 GTGTGAAAGGATAGTGAAGAAGG + Intronic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
979145982 4:117249437-117249459 ATGAGAAAGAAAAGTGAAAAAGG + Intergenic
979831274 4:125307454-125307476 ATGTGAAAGCTGAGAGAAAAAGG + Intergenic
979948051 4:126859495-126859517 AAGGGAGAGAAGAGTGAAGGAGG + Intergenic
980070980 4:128242813-128242835 ATGAGAGATCAGATTGAAGATGG + Intergenic
980805826 4:137812165-137812187 ATGGGAAAGCAGGGTGGAAAGGG - Intergenic
981342365 4:143636248-143636270 CTGGGAAATGAGAGTAAAGAGGG + Intronic
982140315 4:152311056-152311078 ATGGGAAAACAGGTTGGAGAGGG + Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982478722 4:155882823-155882845 AAAGGAAAGCTGTGTGAAGATGG + Intronic
983559748 4:169088839-169088861 ATTTGAAGGGAGAGTGAAGAAGG - Intergenic
984100696 4:175481985-175482007 ATGTGAAAACAGAGGAAAGATGG - Intergenic
984174252 4:176396645-176396667 GTGTGAAAGCAGAGCAAAGAAGG - Intergenic
984234212 4:177136862-177136884 ATGGGACACCAGAGCTAAGATGG + Intergenic
984918417 4:184743482-184743504 AGGGGAGGGCAGAGGGAAGAGGG + Intergenic
984958528 4:185070882-185070904 AGGGGAAAGGAAAGGGAAGAGGG - Intergenic
985109380 4:186533605-186533627 CTGGGAAAGCAGAGTGGTGGAGG - Intronic
985531029 5:433950-433972 GCGGGAAAGCACAGTGAGGATGG + Exonic
985860077 5:2464058-2464080 ACGGGAGAGCACTGTGAAGATGG + Intergenic
985992319 5:3573777-3573799 ACGGGAAAGCAGAATGAATGAGG + Intergenic
986492782 5:8308847-8308869 ATGGGAAGGAAGAGTGGAAAGGG + Intergenic
986605376 5:9517800-9517822 ACAGGAAAGCAGACTGGAGAGGG - Intronic
986668692 5:10125172-10125194 AGGGGGAAGACGAGTGAAGAAGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987011455 5:13770329-13770351 AAGGGCAAGAAGAGGGAAGAGGG + Intronic
987259670 5:16190460-16190482 AAGGGGAAGGAGAGTCAAGAAGG + Intergenic
987335854 5:16896988-16897010 ACGGGAAGGCAGAAGGAAGAAGG + Intronic
987755224 5:22092547-22092569 ATCGAAAACCACAGTGAAGATGG + Intronic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
988105076 5:26734475-26734497 AAGGGAAAGTAGAGTAAAAATGG - Intergenic
989418989 5:41213432-41213454 ATAGGTATGCAGAATGAAGAGGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989748830 5:44866297-44866319 ATGGGAGAGCAGAGGAAGGAGGG - Intergenic
989781456 5:45269907-45269929 AAGGGAAAGTAGAGGGAACATGG - Intronic
990278569 5:54225920-54225942 ATGGGACCCCAGGGTGAAGAAGG + Intronic
991365722 5:65866067-65866089 ATGGGGAAGAAGACAGAAGAGGG + Intronic
991676835 5:69096593-69096615 AATGGTAAGCAGAGTTAAGAGGG - Intronic
991772324 5:70051600-70051622 ATGGGAGAGGAAAGAGAAGATGG + Intronic
991851617 5:70927018-70927040 ATGGGAGAGGAAAGAGAAGATGG + Intronic
992481978 5:77160193-77160215 TTGGGAAGGCAGAGAGAAAAAGG - Intergenic
992702002 5:79350295-79350317 ATGTGAAAGCAGAATCAAAATGG - Intergenic
993085776 5:83361954-83361976 GTGGGAAAGCAGAGAGGAGAGGG - Intergenic
993349601 5:86832330-86832352 ATGAGAAAGCTTAGTGAGGAAGG - Intergenic
994059210 5:95455593-95455615 ATGGGAAAGTAGAGTGTAATGGG + Intergenic
994286002 5:97968495-97968517 ATGACAAAGCAGAGGGAAGTTGG - Intergenic
995078225 5:108013480-108013502 ATGGGAGAACAGAGAGGAGAAGG - Intronic
995653651 5:114400440-114400462 TGGGGAAAACAGGGTGAAGAGGG - Intronic
995685114 5:114764420-114764442 AAGGGAAAGCAGAGAAAAGCAGG - Intergenic
996075221 5:119185102-119185124 AGGTGAAAGCAGAGGAAAGAAGG - Intronic
996337521 5:122400962-122400984 TTGGGTGAGAAGAGTGAAGAGGG - Intronic
996342059 5:122450068-122450090 ATGAGAAATCACAGTGAAAAAGG + Intronic
996605306 5:125313996-125314018 AAGGGGAAGCAGAGTGTAAAAGG - Intergenic
996794538 5:127330489-127330511 CTGGCAAAGGAGATTGAAGAGGG - Intronic
997228210 5:132225419-132225441 GTGGGAGGGCAGAGTGAAAAAGG + Intronic
997258462 5:132447161-132447183 ATGGGAAGTCAGAGTGAGCAAGG - Intronic
997992426 5:138556296-138556318 ATGCCAAAGTAGAGTCAAGACGG + Intronic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999221213 5:149979336-149979358 GTGGGGAGGGAGAGTGAAGATGG + Intronic
999562396 5:152818839-152818861 ACAAGACAGCAGAGTGAAGATGG + Intergenic
1000251188 5:159497331-159497353 AAGGGGAAGCAGAGGGAGGAGGG + Intergenic
1000707172 5:164526327-164526349 CTGTGATAGCAGAGTGAAGAGGG - Intergenic
1001589855 5:172857816-172857838 AAGGCAAAGCAGAGAGCAGATGG - Intronic
1001918329 5:175580622-175580644 ATGGGACAGGAGAGTCAGGAGGG + Intergenic
1002072976 5:176691459-176691481 AGAGGAAAGCAAAGAGAAGAGGG - Intergenic
1003011243 6:2429299-2429321 ATGGGAAAACATAGTGATGTAGG + Intergenic
1003278903 6:4675228-4675250 ATGGGAAAGGGGTGTGAAGGTGG - Intergenic
1003851010 6:10222494-10222516 AAGGGAGCCCAGAGTGAAGAGGG + Intergenic
1004549403 6:16632164-16632186 TTGGGGAAGAAGAGTGAATAGGG - Intronic
1004804802 6:19191278-19191300 CTGGGAAAGAAGATTGAAGTCGG - Intergenic
1005190541 6:23216777-23216799 ATGGGAAAATAGAATGAAAAAGG + Intergenic
1005926537 6:30450010-30450032 ATGGGAAGGCATAGAGAAAAAGG + Intergenic
1006225824 6:32535426-32535448 ACGGGGAAGCCGAGGGAAGATGG + Intergenic
1006630455 6:35426839-35426861 CTGGCAAACCAGTGTGAAGATGG - Exonic
1006857435 6:37144977-37144999 AAGGAAAAGTAGAGTGGAGATGG - Intergenic
1007013244 6:38437862-38437884 ATGGGAAAACAAAATGAAAAGGG + Intronic
1007107738 6:39295235-39295257 ATGGGGAAGCAGGGGGCAGAGGG + Intergenic
1007222884 6:40293162-40293184 TGGGGAAATCACAGTGAAGAAGG - Intergenic
1007509758 6:42365975-42365997 ATGGGAAACAAGATTGAAGAAGG - Intronic
1007520011 6:42444715-42444737 ATGGGAAAGATCAGTGGAGAGGG - Intronic
1007589869 6:43014475-43014497 ATGGGAAAGGAGAGTGTTAATGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1008465249 6:51822868-51822890 ATGGGAAAGCAGAATTGATAGGG - Intronic
1008501457 6:52187570-52187592 ATGGGAAAGGAGAGAGAGGTTGG - Intronic
1008582209 6:52917531-52917553 TTGGGAAAGCAGAGAGTATAAGG + Intergenic
1009349054 6:62651941-62651963 AAGAAAAAGCAGAGAGAAGAGGG - Intergenic
1009834658 6:68984138-68984160 ATGGGAATGCATTGAGAAGAGGG + Intronic
1011025690 6:82867005-82867027 AGGGGAGAGCAACGTGAAGATGG - Intergenic
1011914754 6:92489336-92489358 AAGGGAAAGTAGAGCAAAGAGGG - Intergenic
1012061833 6:94494825-94494847 ATAGGAAAGCAAAGTAAAAAGGG - Intergenic
1012122924 6:95389445-95389467 GTGGGAAAGCAGAGAGCATATGG - Intergenic
1012340055 6:98109751-98109773 ATGGGTAAGCTTAGTGAGGAAGG - Intergenic
1013837845 6:114353806-114353828 ATGAGGAAGCAGAATGTAGAGGG + Intergenic
1013866379 6:114701939-114701961 ATGGGACAGCAGAGGAAAGCTGG - Intergenic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1015533774 6:134246478-134246500 TTGGGAAAAAAGGGTGAAGATGG + Intronic
1015807918 6:137131267-137131289 GAAGGAAAGCAGAGTAAAGATGG - Intergenic
1015851238 6:137574787-137574809 TTGGGAAAGAAGAGTGAAAAAGG + Intergenic
1015890771 6:137967813-137967835 CTGGGACAGCAGAGTGATGGTGG - Intergenic
1015890788 6:137967883-137967905 CTGGGACAGCAGAGTGATGGTGG - Intergenic
1016139043 6:140585723-140585745 ATGAGAAGGCAGAGCCAAGATGG + Intergenic
1016474256 6:144409479-144409501 ATGGGAAAGCACAAGGAAGGTGG - Intronic
1016544139 6:145201704-145201726 CTGGGAAAGAAGAAAGAAGAAGG - Intergenic
1016792366 6:148079173-148079195 GTGAGGAAGGAGAGTGAAGAGGG + Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017550671 6:155503797-155503819 GTGGGACAGAACAGTGAAGAGGG - Intergenic
1017869082 6:158470929-158470951 AGGGGAAGGCAGAGAGAGGATGG + Intronic
1018205806 6:161436197-161436219 ATGGGAGGGCAGAGAGCAGAGGG + Intronic
1018214566 6:161514446-161514468 ATGGGGAAAAAGGGTGAAGAAGG + Intronic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1019151732 6:170010953-170010975 AAGGGAAAGGAGAGGGAATAAGG + Intergenic
1019517418 7:1446173-1446195 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019517475 7:1446317-1446339 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019517514 7:1446423-1446445 TAGGGAGAGAAGAGTGAAGAGGG + Intronic
1019738956 7:2663424-2663446 ATGGGAGGGCAGAGTGGGGAGGG + Exonic
1020173393 7:5863416-5863438 ATGGCACAGGAGAGGGAAGAGGG + Intergenic
1020178348 7:5900873-5900895 ATTGAAAAACAGAGTAAAGATGG + Exonic
1020304577 7:6824126-6824148 ATTGAAAAACAGAGTAAAGATGG - Exonic
1020506332 7:8993380-8993402 ATGGGAAAGGAGACTGACTAGGG - Intergenic
1021281898 7:18730224-18730246 GTGGAATAGCAGAGTGAAGATGG - Intronic
1021576262 7:22108721-22108743 ATGGGAAAAAAGGGTGAAGAAGG + Intergenic
1021638036 7:22710622-22710644 AAGGGAAAACAGAATGAAAAGGG + Intergenic
1022569946 7:31442525-31442547 ATGAGAGAGCAGAGAGGAGACGG + Intergenic
1022774642 7:33513290-33513312 ATGGGAAGCCAGAATAAAGAGGG - Intronic
1022892137 7:34712307-34712329 ATGGAAAAGTAGAGTGGAGAAGG - Intronic
1023455143 7:40330434-40330456 TTAGGAAAGAAGGGTGAAGAGGG + Intronic
1023716205 7:43046719-43046741 ATGAGAAGGAAGAGTAAAGAGGG + Intergenic
1023802014 7:43843386-43843408 TTGGCAAAGCAAAGGGAAGATGG - Intergenic
1024159915 7:46663516-46663538 CTGGGAAAGCAGAGGGAGTAAGG + Intergenic
1026467495 7:70667003-70667025 GTGGAAAGGCAGAGAGAAGAGGG - Intronic
1026661140 7:72303668-72303690 ATTGGAAAAGAGAGTGAAGGAGG - Intronic
1027191916 7:76001442-76001464 AGGGGAAAGAAGAGAGGAGATGG - Intronic
1027330481 7:77087661-77087683 ATGTCAAAGCAGTGTGTAGAGGG - Intergenic
1027358466 7:77383575-77383597 ATGGGAGAGCACAGAGAAGGAGG - Intronic
1027560413 7:79721711-79721733 ATGGGAAAGAAGAGAGATGAGGG - Intergenic
1028325017 7:89512866-89512888 ATGAGAGGGCAGAGAGAAGAAGG - Intergenic
1028455372 7:91032564-91032586 AAGAGAAAGCAGTGTGAAGAGGG + Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1029248707 7:99220855-99220877 GGGGGAAAGGAGAGGGAAGAAGG + Intergenic
1029785279 7:102783673-102783695 ATGTGAAAGCAGTGTGTAGAGGG + Intronic
1030422231 7:109321998-109322020 ATGTGAGAGTAGAGTGAAGCAGG + Intergenic
1030431542 7:109455269-109455291 ATGGGAGGGAAGAGTGAAAAAGG - Intergenic
1033673872 7:143519022-143519044 ATGGGAAAGCTGAGGCAAAACGG + Intergenic
1033779748 7:144654488-144654510 AAAGGAAAGAAGGGTGAAGAGGG + Intronic
1034427190 7:151020259-151020281 CTGGGAAAGCTGAGTGAAACTGG - Intronic
1034737836 7:153445577-153445599 ATGAGAAAACAGCGTGGAGAAGG + Intergenic
1035341368 7:158164720-158164742 ATGGGATAGGAGAGAGAAAAGGG + Intronic
1036286995 8:7451632-7451654 AGGAGACAGCAAAGTGAAGAAGG + Intronic
1036334486 8:7859889-7859911 AGGAGACAGCAAAGTGAAGAAGG - Intronic
1036741283 8:11363956-11363978 TTGTGAAAGTAGAGTGAAAAAGG - Intergenic
1036865108 8:12389604-12389626 ATGGGAGAGCAGATGGCAGAAGG - Intergenic
1036956438 8:13192803-13192825 AGGGCAAAGCAGAGAGAAGGTGG + Intronic
1037541512 8:19876392-19876414 AAGGGAGTGGAGAGTGAAGAGGG - Intergenic
1037590359 8:20306732-20306754 ATGAGAAGGCAGAGTGGAGAAGG + Intergenic
1037824719 8:22154515-22154537 ATGGGAAAGCAGAAGGGAGGGGG - Intronic
1037942540 8:22963202-22963224 ATGGGAAAGAAGAGGGGAAAGGG + Intronic
1037949696 8:23010846-23010868 ATGAGGACACAGAGTGAAGAAGG + Intronic
1038084807 8:24183816-24183838 ATTGAAAAGCAGTGTTAAGAGGG - Intergenic
1038415077 8:27389239-27389261 ATAGGAAGGCAGAGAGAGGAGGG + Intronic
1038440676 8:27569085-27569107 ATGGGAAAGAACAGTAGAGATGG - Intergenic
1038463851 8:27741848-27741870 ATAAGAAAGCAGAGTCAGGATGG + Intronic
1038546303 8:28428076-28428098 ATGAGAATGCAGGGAGAAGACGG + Intronic
1038570467 8:28657918-28657940 ATGGGAAGGCAGAAAGAGGAAGG - Intronic
1038948674 8:32390105-32390127 ATGGGAAAGCAGAGTGAAGAGGG - Intronic
1039099373 8:33924487-33924509 AGGGCAAAGGAGAGGGAAGAAGG - Intergenic
1039462616 8:37758574-37758596 ATGGGATAGCACATAGAAGAAGG + Exonic
1039839381 8:41282625-41282647 ATGGGAAAGCATTTTGAACATGG + Intronic
1039963800 8:42269652-42269674 AAGAGAAAGGAGAGGGAAGAGGG + Intergenic
1040324246 8:46333663-46333685 ACGGGAAGGCAGGGTGAAGTGGG + Intergenic
1040979928 8:53236426-53236448 CTGGGAAGGCATTGTGAAGACGG + Intronic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1042350701 8:67774454-67774476 AGGAGAATGCAGAGTGGAGAAGG + Intergenic
1042648107 8:71009655-71009677 ATGGGGAAGAAGAGTGCTGAGGG + Intergenic
1042705084 8:71658153-71658175 ATGGGAAATCAGAGAGAGAAAGG - Intergenic
1042854264 8:73249840-73249862 AAAGGAAAGCTGAGGGAAGATGG + Intronic
1043026493 8:75076742-75076764 ATGGGAAGGCAAGGAGAAGAGGG - Intergenic
1043660961 8:82739932-82739954 ATCAGAGAGCAGAGGGAAGATGG + Intergenic
1043779712 8:84316138-84316160 CTGGGAAATCAGAGTAAAGATGG - Intronic
1044259600 8:90102172-90102194 ATGGGTAAGCCTAGTGAGGAAGG - Intergenic
1044438882 8:92199628-92199650 AGGAGAAGGCAGTGTGAAGATGG - Intergenic
1044505875 8:93018709-93018731 TTGGGAAAGGAAAGAGAAGAAGG + Intergenic
1044953153 8:97452915-97452937 ATTGGAAAGAAGAAAGAAGAAGG + Intergenic
1045083999 8:98660808-98660830 ATGGGAAAGTGAAGAGAAGAGGG - Intronic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045188987 8:99864963-99864985 AGGGTGAAGCAGAGTCAAGAAGG - Intronic
1045970750 8:108077306-108077328 ATTGGAAAGCAGTGTGAAGAAGG + Intronic
1046727711 8:117692766-117692788 ATGGAAAAACAGAGTGGAGCAGG - Intergenic
1046885217 8:119359597-119359619 ATGGAAAAGAAGAGGGAAAATGG - Intergenic
1047031199 8:120883122-120883144 AAGGGAAAGCAGACTAAAGATGG + Intergenic
1047073618 8:121375687-121375709 AGGGGAAACAAGAGTGTAGAGGG + Intergenic
1047404411 8:124573247-124573269 GAGGGACAGCAGAGTGAAGATGG - Intronic
1047924877 8:129672893-129672915 CTGAGAAAGCAGAGAGAACAAGG - Intergenic
1048194820 8:132323622-132323644 ATGGGAAGTCAGAGAGAGGATGG - Intronic
1048477162 8:134754097-134754119 CTGGGGAAGCAGGGTGAAAAAGG + Intergenic
1048607946 8:135989694-135989716 ATGGGGCAGCACAGTGAAGATGG - Intergenic
1048609259 8:136004163-136004185 ATGGGAAATGGGAGAGAAGATGG + Intergenic
1048817507 8:138347662-138347684 ATCAGCAAGCAGAGTGATGATGG - Intronic
1049793522 8:144484631-144484653 AGGGGAAAGGAAATTGAAGAGGG + Intronic
1050985453 9:12076601-12076623 AGGGGAGAGGAGAGTGGAGAGGG - Intergenic
1051029549 9:12658122-12658144 AAGGGCAAGCAGAGTGGTGAGGG + Intergenic
1051150285 9:14072330-14072352 AGGGGAGAGGAGAGTGAAGAGGG + Intergenic
1051220461 9:14843295-14843317 ATGGGCAAGGGGAGTGGAGAGGG - Intronic
1051393272 9:16589815-16589837 AGGGGAAAGAAGAGTTAAAAAGG - Intronic
1051871414 9:21741924-21741946 ATGGGACACCAGGGTGCAGATGG + Intergenic
1052352094 9:27468466-27468488 CTGGTAAAGCAGAGGGAACAAGG + Intronic
1052951838 9:34219771-34219793 ATGGGAAAGGGGAGAGGAGAAGG - Intronic
1053385406 9:37683454-37683476 ATGAGAAAACAGACTGTAGAGGG + Intronic
1053576294 9:39359268-39359290 CTGGGAAAGAAGATTGAAGATGG - Exonic
1053840805 9:42187193-42187215 CTGGGAAAGAAGACTGAAGATGG - Exonic
1054097863 9:60917959-60917981 CTGGGAAAGAAGATTGAAGATGG - Intergenic
1054119265 9:61193589-61193611 CTGGGAAAGAAGATTGAAGATGG - Exonic
1054588488 9:66988973-66988995 CTGGGAAAGAAGATTGAAGATGG + Intergenic
1055486775 9:76763796-76763818 ATGGGGAAGCATGGGGAAGAGGG + Intronic
1055489792 9:76793118-76793140 CAGGCAAAGCAGAGTGCAGAAGG + Intronic
1055686038 9:78775809-78775831 ATGGGAAAGATGAGTGCAGTTGG + Intergenic
1055986517 9:82060142-82060164 CTGGGAAAGAGGATTGAAGATGG + Intergenic
1056075877 9:83039708-83039730 AAGGGAAAAAATAGTGAAGAAGG - Intronic
1056519766 9:87389438-87389460 TAGGGAAAGCTGAGTGAGGAAGG - Intergenic
1056584827 9:87920990-87921012 CTGGGAAAGAGGATTGAAGATGG - Intergenic
1056612054 9:88131950-88131972 CTGGGAAAGAGGATTGAAGATGG + Intergenic
1057113393 9:92497086-92497108 GTGGGAATGCAGAGTGCAAAGGG - Intronic
1057160648 9:92886043-92886065 CTGGGAAAGAGGATTGAAGATGG - Intergenic
1057220971 9:93257526-93257548 ATGGGTAAGCTGAGGGCAGATGG - Intronic
1057317581 9:93979619-93979641 CTGGGACAGCAGAGTGAGTATGG - Intergenic
1057647809 9:96893500-96893522 ATGGGATGGCTGAGTCAAGATGG - Intergenic
1057861646 9:98645416-98645438 ATGGGAAAGAAGCTAGAAGAAGG + Intronic
1058072376 9:100614526-100614548 AAGGGAAACCACAGTAAAGAAGG + Intergenic
1058681036 9:107440429-107440451 AGAGGAAAGGAGAGGGAAGAGGG + Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058832375 9:108830902-108830924 CTGGGAAGGCACAGAGAAGATGG + Intergenic
1059099563 9:111456824-111456846 ATGGGTAAAAAGAGTGGAGAGGG + Intronic
1059229825 9:112709377-112709399 ATGGGAAAACAGAATGAATAAGG + Intronic
1059425230 9:114216760-114216782 ATTGGAAGGGAGATTGAAGATGG + Intronic
1060497917 9:124131405-124131427 ATGGGGAAGCAGAGGGGAGCGGG + Intergenic
1060701135 9:125748908-125748930 AGGCGAAAGGAGAGGGAAGAGGG - Intronic
1060716326 9:125933232-125933254 ATGGGAAGTCAGAGTGAGCAAGG - Intronic
1061281937 9:129602583-129602605 AGGGAAAAACAGAGAGAAGAAGG + Intergenic
1061466610 9:130785508-130785530 AAGGGCAGGTAGAGTGAAGAGGG - Intronic
1061855100 9:133437726-133437748 CTGGGAGGGCAGAGTGAAAAAGG - Intronic
1061984402 9:134121550-134121572 ATGGGAAAGCAGAAGCAAGGTGG + Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1186092778 X:6067627-6067649 ATGGGAAAGGAGAGAGCAGGGGG - Intronic
1186253298 X:7692329-7692351 ATGTGAAAACAGAGAGAAGACGG + Intergenic
1186270490 X:7881511-7881533 ATGGGAAAACAGAGTGATCAAGG - Intergenic
1186289503 X:8081019-8081041 ATGGGGAAGCAGAGCACAGAAGG + Intergenic
1186839522 X:13471211-13471233 AAGGAAAAGCAGAGTAAGGAGGG + Intergenic
1187733613 X:22281855-22281877 AAGGGAAAGCAGAGTAAGTAAGG - Intergenic
1188347757 X:29088276-29088298 ATAGGAAAGCAAAGAGAAGATGG - Intronic
1188902637 X:35752931-35752953 AAAGCAAAGGAGAGTGAAGATGG + Intergenic
1189078714 X:37945492-37945514 ATGGGAAAGCAGGGTGGTGTTGG + Intronic
1189197126 X:39162157-39162179 ATGGGAAAGGAGAGGAAAGAAGG - Intergenic
1189230795 X:39451036-39451058 AAGGGGAAGCAGAGGGAGGAAGG - Intergenic
1189268355 X:39733443-39733465 ATGGGAATTCAGGGTGTAGAGGG - Intergenic
1189837328 X:45039191-45039213 ATGGGGAGGCAAAGTGCAGATGG - Intronic
1190022338 X:46890597-46890619 ATGGGAGAAAAGACTGAAGATGG + Intronic
1190596601 X:52058465-52058487 CAGGGAAAGCAGTGTTAAGAGGG - Intergenic
1190612223 X:52195608-52195630 CAGGGAAAGCAGTGTTAAGAGGG + Intergenic
1192435610 X:71141817-71141839 TTGGGAAAGGAGGTTGAAGAAGG + Intronic
1192779432 X:74278889-74278911 ATGCCAGGGCAGAGTGAAGAAGG + Intergenic
1193399063 X:81020904-81020926 ATGTGCAAGCAAAGTGATGAAGG + Intergenic
1194211017 X:91068932-91068954 ATGTTAAAGCAGTGTTAAGAAGG + Intergenic
1194440097 X:93921530-93921552 ATAGAGAAGCAGTGTGAAGAAGG - Intergenic
1194465996 X:94236359-94236381 AAGGGAAAGGAGAGAGAGGAAGG - Intergenic
1194897516 X:99463116-99463138 ATGGCAAAGCTGATTGAATATGG - Intergenic
1195459076 X:105103341-105103363 ATGGGAAACCAGAGCAAACAGGG - Intronic
1195849721 X:109270174-109270196 CTGGGATAGCAGTGTGAGGATGG - Intergenic
1196059821 X:111395915-111395937 TTGGGAAAGCAGAGATAACAGGG + Intronic
1197603590 X:128559498-128559520 ATGGAAGATCAGAGTGATGACGG + Intergenic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198112773 X:133516255-133516277 ATGGGAAAGCAGAACACAGAGGG - Intergenic
1198218100 X:134575038-134575060 TTGGGAAATCAGAGGCAAGATGG + Intronic
1198682162 X:139194733-139194755 GTGGGGAAGCAGCGTTAAGATGG - Intronic
1198873128 X:141196552-141196574 ATGGGATATCAGAGAGAAAAAGG - Intergenic
1199178729 X:144825815-144825837 ATTGAAAAGCAGAAAGAAGATGG - Intergenic
1199768261 X:150956404-150956426 CAGAGAAGGCAGAGTGAAGAGGG - Intergenic
1201107779 Y:10776245-10776267 ATGGAAAAGCATAGAGAAGAAGG - Intergenic
1201412532 Y:13714876-13714898 ATGGGAGAGAAGAGTTTAGAAGG - Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202048878 Y:20760638-20760660 GTGGGAGAGGAGAGTGGAGAAGG + Intronic