ID: 1038953762

View in Genome Browser
Species Human (GRCh38)
Location 8:32445185-32445207
Sequence AGTATTCAGGAGGATATACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 10, 3: 29, 4: 191}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038953762 Original CRISPR AGTATTCAGGAGGATATACA AGG (reversed) Intronic
902233793 1:15044795-15044817 AATATTTGGGAGGAAATACATGG + Intronic
902855105 1:19197057-19197079 AGTATTCAGGAGGATTTTCATGG + Intronic
903486483 1:23692763-23692785 AGTAGTCACAAGGACATACAGGG + Intronic
903626483 1:24734320-24734342 AGCATTTAGGAGGATATCCATGG - Intergenic
906820519 1:48925302-48925324 AGTATACAGGAGTATATGCATGG - Intronic
907411992 1:54289678-54289700 AGGATGCAGGAGGTGATACAGGG + Intronic
909174670 1:72341546-72341568 CAGATTCAGGAGGATATACCTGG - Intergenic
911429087 1:97760534-97760556 AGTATACAGGAGGATGTGGAAGG + Intronic
911763682 1:101646610-101646632 AGTATACAGAAGGATGTGCATGG - Intergenic
912487681 1:110041921-110041943 AATATTCAAAAGGATATTCAAGG - Intronic
913038201 1:114995797-114995819 AGTATTAAGGAGTATAAAGAAGG + Intergenic
914202917 1:145502416-145502438 ACTACTCAGGAGGATATAGTGGG + Intergenic
914236849 1:145820351-145820373 ACTACTCAGGAGGATATAGTGGG + Intronic
914482040 1:148075567-148075589 ACTACTCAGGAGGATATAGTGGG + Intergenic
914560888 1:148818644-148818666 AGTATTCAGCTGAATATTCAAGG + Intronic
914611946 1:149311566-149311588 AGTATTCAGCTGAATATTCAAGG - Intergenic
917005466 1:170411492-170411514 AGTATTCTAGAGAATATAGAAGG - Intergenic
919052083 1:192523973-192523995 AGTATACAGTATGATAAACATGG - Intergenic
922224971 1:223638224-223638246 AGTATATGGGAGGATATGCATGG + Intronic
923221801 1:231901865-231901887 AGAATTCAGGATAAGATACAAGG - Intronic
924572734 1:245252577-245252599 AATATTCAAGAGGATCCACAAGG - Intronic
1064672520 10:17731304-17731326 ATTCCTCAGGTGGATATACAAGG - Intergenic
1069097242 10:64273783-64273805 AGAATTAAGGATGATATACAAGG + Intergenic
1069833613 10:71295497-71295519 AATATACAGATGGATATACAAGG - Intronic
1072923275 10:99594700-99594722 ATTATGAAAGAGGATATACAGGG + Intergenic
1075063093 10:119270466-119270488 AGTGTATAGGAGGATATGCATGG + Intronic
1076341538 10:129750638-129750660 AGTCTACAGGAGGATGTGCAAGG + Intronic
1077450996 11:2645464-2645486 AGCATTCAGCAGGGTATACAGGG - Intronic
1078293939 11:10046083-10046105 AATATACAGGAGGATATGCATGG + Intronic
1078532887 11:12150645-12150667 ATTAGTCTGGAGGATATAGAGGG - Intronic
1078709853 11:13780520-13780542 AGTATACAAGAGGATATGCATGG - Intergenic
1079397340 11:20076194-20076216 GGTATTCAGAAGGAACTACAGGG + Intronic
1080443982 11:32320707-32320729 AGAATTGAAGAGGATTTACATGG - Intergenic
1080885657 11:36365434-36365456 AATATTCAGCAGGATATAATTGG - Intronic
1081096180 11:38938939-38938961 AGCATTCATGAGGAGATACAGGG - Intergenic
1082866472 11:57904184-57904206 AGGATGCAGGAGGAGAAACAAGG - Intergenic
1084495894 11:69502882-69502904 AGTATGCAGGAGGATGTGCCTGG - Intergenic
1085482227 11:76832276-76832298 TGTTTTCAGGATGATATATATGG + Intergenic
1088836022 11:113578478-113578500 AGAATGCAGGAAGATATAGAGGG + Intergenic
1091609941 12:1997741-1997763 AGTATTCATCACGATATACCAGG + Intronic
1091728686 12:2864033-2864055 ATTATTAAGGAAGATACACAAGG - Intronic
1091872202 12:3903207-3903229 AGTATACAGGAGGATGTGCATGG - Intergenic
1094194099 12:27727897-27727919 AGTATATAGGAGGATGTACTAGG - Intronic
1098432648 12:70436680-70436702 AATATTCAGAAGGCTACACAAGG + Intergenic
1098597501 12:72291737-72291759 AGTATACAGGAAGACATGCATGG + Intronic
1098708849 12:73727976-73727998 AGTATACAGGAGGATGTGCATGG + Intergenic
1098716907 12:73840435-73840457 AGTATTTAGGAGGATTTGTAGGG - Intergenic
1100995616 12:100297561-100297583 AGTAGTCAGGAAGAGAGACAAGG - Intronic
1101192348 12:102348081-102348103 AGTTTCTAGGAGGATATGCATGG - Intergenic
1101192431 12:102348874-102348896 TTTTTTCAGGATGATATACATGG + Intergenic
1102106547 12:110329125-110329147 AGTATACTGGAGGATGAACAAGG - Intronic
1104870075 12:131988744-131988766 AGTAATGAGGAGGATAAAGAAGG - Intronic
1105358215 13:19679650-19679672 AGTATACAGGAGGATGTACATGG + Intronic
1106100324 13:26689786-26689808 AGTACTAAGGAGGAAATGCAAGG - Intergenic
1107732064 13:43358423-43358445 AGGGTTCTGCAGGATATACATGG + Intronic
1111453571 13:88450597-88450619 AGTATTGTGAAGGATATCCAGGG + Intergenic
1114415322 14:22538972-22538994 AGTATTCAGGAGGGTTTCCCAGG + Intergenic
1117177827 14:53163303-53163325 AGTATACAGGAGGATATGCATGG - Intergenic
1118964319 14:70565787-70565809 AGTATACAGGAAGATGTACATGG + Intergenic
1120117222 14:80633986-80634008 AATATTAAGGAAGATATGCATGG - Intronic
1120290846 14:82568889-82568911 AGTATACACGGGTATATACAGGG + Intergenic
1120594962 14:86422084-86422106 AGTTTTCAGGAGAATTTTCAGGG + Intergenic
1125011659 15:34883406-34883428 AGTAGGCAGAAGGTTATACAGGG - Intronic
1125362646 15:38880324-38880346 AGTACTCAGGAGAACAAACAAGG + Intergenic
1125697970 15:41655139-41655161 AGTATATGGGAGGATGTACATGG - Intronic
1126296859 15:47148878-47148900 GGTATTAAGTAGGATATAAAAGG - Intergenic
1126474067 15:49047409-49047431 AGTATATCGGAGGATATGCATGG + Intergenic
1127239455 15:57096557-57096579 AGTATACAGGAGGATATGTGTGG - Intronic
1128822751 15:70674999-70675021 AAAATTTAGGAGTATATACAGGG - Intronic
1130425181 15:83790349-83790371 AGTATTAAGAAAGATATAAAAGG + Intronic
1135911929 16:26569272-26569294 AGTATATGGGAGGATATGCATGG + Intergenic
1137313637 16:47292515-47292537 AGTATTCATGAGTAAATAAAAGG - Intronic
1137548747 16:49422220-49422242 GCTATTCAGGAGGATGTCCATGG + Intergenic
1138991955 16:62401275-62401297 AGTATCTAGGAAGATATAGATGG + Intergenic
1143816892 17:9524162-9524184 AGGATTCAAGAAGATACACAAGG + Intronic
1146859972 17:36288513-36288535 ATCATTCTGGAGGATATCCAAGG - Intronic
1146889041 17:36493090-36493112 AGTATTCAGGAGAAGAAAAATGG + Intronic
1147090298 17:38092606-38092628 ATCATTCTGGAGGATATCCAAGG - Intergenic
1147106915 17:38227920-38227942 ATCATTCTGGAGGATATCCAAGG + Intergenic
1147929306 17:43967672-43967694 AGCATTCAGCAGGAGAGACAGGG - Intronic
1148422611 17:47560624-47560646 ATCATTCTGGAGGATATCCAAGG - Intronic
1148840583 17:50493731-50493753 AGGATTGGGAAGGATATACATGG - Intergenic
1149392678 17:56207820-56207842 ATTATTAAGGAGGATCTAAAAGG - Intronic
1149785767 17:59433675-59433697 GGTCTTCAGGAGAAGATACATGG + Intergenic
1152053967 17:78007198-78007220 AGTATTTTAGAGGATATAGAAGG - Intronic
1152284242 17:79403211-79403233 AGCCATCAGGAGGACATACAGGG - Intronic
1153916985 18:9754683-9754705 AGTGTACAGGAGGATGTGCATGG + Intronic
1155068653 18:22292564-22292586 AGTATACAGGAGGATATGCATGG - Intergenic
1155176956 18:23308998-23309020 AATATACAGGAGGATGTGCATGG - Intronic
1155759377 18:29547031-29547053 AGTATACAGGAAGATCTAGAAGG + Intergenic
1158789454 18:60759621-60759643 AATTTTCAGGGGGATATTCAGGG + Intergenic
1159444839 18:68529052-68529074 AGTATACAGGAAGATGTGCATGG + Intergenic
1161677486 19:5660215-5660237 AGTGTACAGGAGGATGTACATGG - Intronic
1165498778 19:36171045-36171067 AAAATTCATGAGGATAAACAGGG + Intergenic
1167387855 19:49174843-49174865 AGTATTCAGGAAGATTCCCAGGG + Intronic
1167779194 19:51586038-51586060 AGTTTTCAGAAGGATATACAGGG + Intronic
1168190756 19:54737164-54737186 TGTATACAGGAGGATGTGCATGG + Intronic
1168203127 19:54831303-54831325 TGTATACAGGAGGATGTGCATGG + Intronic
1168205682 19:54849094-54849116 TGTATACAGGAGGATGTGCATGG + Intronic
1168208152 19:54867735-54867757 TGTATACAGGAGGATGTGCATGG + Intergenic
1168488498 19:56786511-56786533 ATTATTTTGGAGGAAATACATGG + Intronic
926666945 2:15535609-15535631 AGTATACAGGAGGATATGTGTGG - Intronic
931049985 2:58401919-58401941 ATTATTCTGGAGTATCTACATGG - Intergenic
933404980 2:81846485-81846507 ACTATACAGGAGGATATACATGG - Intergenic
934535967 2:95133733-95133755 AGTCTACAGGAGGATGTGCATGG + Intronic
934720731 2:96574303-96574325 ATGATACGGGAGGATATACATGG + Intergenic
935537019 2:104307085-104307107 AGTATTCAGGAGCAAATTCAAGG + Intergenic
935624510 2:105159975-105159997 AGAATTCAGCAAGATATAAAAGG + Intergenic
937773079 2:125744987-125745009 AGTAATCAGAAAGATATGCAAGG + Intergenic
938402019 2:131001527-131001549 AGTATTGGTGAGGATGTACAGGG + Intronic
939681260 2:145136529-145136551 AGGATTCAGGAAAATATACCTGG + Intergenic
940447407 2:153792389-153792411 AGTATACAGGAGGATGTGCATGG + Intergenic
941471208 2:165889707-165889729 AGTATTCAGGAGAAGATGCATGG - Intronic
941594138 2:167454909-167454931 AGGATCCAGAAGTATATACAGGG + Intergenic
943893299 2:193319979-193320001 AGTATACAGGAGGATGTGCATGG + Intergenic
943943333 2:194026555-194026577 AGTATACAGAAAGATATGCATGG - Intergenic
947054207 2:226082935-226082957 AGTATTCACATGGATATACATGG + Intergenic
947836143 2:233177016-233177038 AGTAGTCAGGAGGATATGTGAGG + Intronic
1169423914 20:5481610-5481632 AGTATTTAGGTGGGTATCCATGG + Intergenic
1169870519 20:10243536-10243558 AGTCTTCAGGAGCATTGACAGGG + Intronic
1169881040 20:10346978-10347000 AGTATTTAGGAGGAAAAAAATGG - Intergenic
1171279792 20:23886413-23886435 AGTATACAGGAGGATGTGCATGG + Intergenic
1171335371 20:24380807-24380829 AGTATTCAGGAAGAAACACCTGG - Intergenic
1173134239 20:40425144-40425166 AGAATCCATGAGGATAGACATGG + Intergenic
1175649352 20:60704336-60704358 AATATTCAAGAGGATGTTCATGG - Intergenic
1176672380 21:9746533-9746555 AGGACTCAGGAGAATTTACATGG - Intergenic
1177770915 21:25514571-25514593 ACTTTTAAGGAGAATATACATGG - Intergenic
1182145512 22:27994632-27994654 AGTATCCAGGAGGAGTTAGAAGG + Intronic
1182709705 22:32312815-32312837 GGTTTTCTGGAGGAAATACAAGG + Intergenic
1183474038 22:38026187-38026209 AGTGCTCAGGAGGATGGACAAGG - Intronic
1184397264 22:44249680-44249702 CGTTTTCTGGAGGAAATACAAGG + Exonic
949280888 3:2345160-2345182 TGTATTCAGAAGCATATGCATGG - Intronic
949813286 3:8031139-8031161 AGTATTCAGAAGAATAAAAAGGG - Intergenic
957245217 3:77707861-77707883 AGCATTCAGGAGGATCTACAGGG - Intergenic
957645661 3:82921466-82921488 ACTAATCAGCAGAATATACAAGG - Intergenic
957964833 3:87308600-87308622 AGTACACAGGAAAATATACAGGG - Intergenic
958825437 3:99024499-99024521 AATATTCAGGAGAAAATACTTGG - Intergenic
960242057 3:115355849-115355871 ATTATTCAGCAGAATATATAAGG + Intergenic
960825571 3:121780042-121780064 AGTATTCTGGAGAATACTCAAGG + Intronic
963723851 3:148896679-148896701 AGTATGCTTGAGGATATACTTGG - Exonic
967444606 3:189551299-189551321 ATTATACAAGAGGAAATACAGGG + Intergenic
970935052 4:21559519-21559541 AGTATACAGAAGGACACACATGG + Intronic
971896299 4:32600671-32600693 AGTATTCAAGAGGATAAAAAGGG - Intergenic
972463342 4:39327839-39327861 AGTATACAAGAGGCTAGACATGG + Intronic
973073805 4:45898159-45898181 CGTATTCAGGGGGATAAAGAAGG - Intergenic
973627444 4:52787201-52787223 TTTATTCAGGAGAATATAAAAGG - Intergenic
973658196 4:53073218-53073240 AGAATACAGGAGGATGTGCATGG + Intronic
973815554 4:54616126-54616148 AGTATTCAGAAGGCTCTACTGGG + Intergenic
974155958 4:58072980-58073002 AGTATTCTGAATGATATCCAGGG + Intergenic
974261746 4:59533665-59533687 ATAATTCAGGAGGAAATAAATGG + Intergenic
975123981 4:70761168-70761190 GGTGTTTGGGAGGATATACATGG + Intronic
975309944 4:72892542-72892564 AGAATTCACAAGGATACACAAGG - Intergenic
975687383 4:76930866-76930888 AGTATGCAGAAGGATGTGCATGG - Intergenic
975968487 4:80004669-80004691 ATTATTCAGGATGATCTAGATGG - Intronic
977083315 4:92561049-92561071 AATATTCAGGAAGATATCAAAGG - Intronic
977779147 4:100959884-100959906 AATATTCAGGAGGGTAAAAAAGG - Intergenic
978074490 4:104512096-104512118 AGCATCCAGGAGAGTATACATGG + Intergenic
980447774 4:132933392-132933414 AGTATTCATGGGCATAAACAAGG + Intergenic
980665047 4:135922332-135922354 AGTTTTCAGGAGAATTCACAGGG + Intergenic
980835305 4:138184650-138184672 AGTATTCAAAAGGATATACTAGG + Intronic
982865026 4:160499754-160499776 AGGATTCAGGAGGATCTGAAGGG - Intergenic
985044202 4:185923873-185923895 AGTATTCAGGAAAGTATCCAAGG - Intronic
985263174 4:188133978-188134000 AGTATACAGGAGGATGTGCAGGG + Intergenic
985402349 4:189605309-189605331 AGGACTCAGGAGAATTTACATGG + Intergenic
987457733 5:18167298-18167320 ACTATACAGGTGAATATACAAGG - Intergenic
991235045 5:64384210-64384232 TGTATTCATTAGGATATACAGGG - Intergenic
992967845 5:82021434-82021456 AGTATACAGGAGGATGTGCATGG - Intronic
993358604 5:86945301-86945323 AATAATCAAGAGGATATACCAGG + Intergenic
993391500 5:87323895-87323917 AGTAAGTAGGAGGATACACAGGG - Intronic
993878317 5:93335230-93335252 ACTATACAGGAGGATAAAAAAGG + Intergenic
995861517 5:116645847-116645869 ATTTTTCAGGAGGATGTGCATGG - Intergenic
997168054 5:131683267-131683289 AGTATACAGGAGGATGTGCATGG - Intronic
997290250 5:132727334-132727356 AGTATTCAGAATGAGAAACAGGG + Intronic
1001006319 5:168053659-168053681 ATTATAGAGGAGGACATACATGG + Intronic
1002613758 5:180437590-180437612 AGAATACAGGAGGAGACACATGG - Intergenic
1005601530 6:27431178-27431200 AGTTCTGAGGAGAATATACAGGG - Intergenic
1006683185 6:35811825-35811847 AGTGTTCAGGAAGATACCCACGG - Intronic
1007293759 6:40805872-40805894 AGTACTCAGGAGAGGATACACGG - Intergenic
1008558917 6:52704345-52704367 AGCATTCAAGAGGATTTTCAAGG + Intergenic
1010837445 6:80607717-80607739 AGTATTCTTGAGGACATTCATGG + Intergenic
1010870174 6:81026988-81027010 AGAATTCTGGAGGATAAACTGGG + Intergenic
1011741337 6:90363584-90363606 AGTAATCAGGAAGAAATCCAGGG - Intergenic
1014165147 6:118215852-118215874 TGTATTCAGAAGGAAAAACAAGG + Intronic
1014476817 6:121883449-121883471 AGTAGCCAAGAGGATTTACACGG - Intergenic
1014818328 6:125958609-125958631 AGTATTCAGGAGGTAAAACAGGG + Intronic
1014876660 6:126669571-126669593 AGTATTCCTGAGGTTCTACAGGG + Intergenic
1015648893 6:135431283-135431305 TGTATTCAGGAGATTGTACAGGG - Exonic
1018325307 6:162661439-162661461 AGTAGTAATGAGGATATACAAGG + Intronic
1019847912 7:3525109-3525131 AGTGTACAGGAGGATGTGCATGG + Intronic
1020778693 7:12491042-12491064 AGTATTCAGGACCATCTACAAGG + Intergenic
1021362671 7:19734888-19734910 AGTATTCAGGACAATAAATAGGG + Intronic
1022131698 7:27410672-27410694 AGTTTTCTGGAGTATATACCTGG - Intergenic
1023127102 7:36965264-36965286 AGTAGTGAGGAGGAAAGACAAGG - Intronic
1024494396 7:50027471-50027493 AGTATTCAGAAGGAAATGTATGG + Intronic
1024841716 7:53594605-53594627 AATATTCATGACAATATACAAGG - Intergenic
1026520010 7:71108946-71108968 ACTATTCAGATGGATGTACAGGG - Intergenic
1026617437 7:71918261-71918283 AGTCTTCAGGTGGATAAAAATGG - Intronic
1028541945 7:91952238-91952260 AGTATTCAGAGTGATCTACAGGG + Intronic
1029813659 7:103073632-103073654 TGTGTTCAGGAGGATGTACAAGG - Intronic
1030861208 7:114632000-114632022 AATATACAGGAGGATCTGCAGGG + Intronic
1035131089 7:156654326-156654348 AGTATACAGGAGGATATGCATGG + Intronic
1038917547 8:32041358-32041380 TGTATTCAGTAGGACAGACAGGG - Intronic
1038953762 8:32445185-32445207 AGTATTCAGGAGGATATACAAGG - Intronic
1041976921 8:63809992-63810014 ATTATTCAGGCTGTTATACAAGG + Intergenic
1042435977 8:68764858-68764880 AGTTTTCAGGAGTAAATTCATGG - Intronic
1042502163 8:69521424-69521446 AGTGTTAAAGAGGATTTACAAGG + Intronic
1042970624 8:74404923-74404945 AGTATACAGGAGGATATGCATGG - Intronic
1043576454 8:81664241-81664263 ATTTTCCAGGAGGGTATACAGGG - Intronic
1044015395 8:87044433-87044455 AATATTAAGGAGCATAGACACGG + Intronic
1044025205 8:87161098-87161120 ATTCTTCATGAGGATATTCAAGG + Intronic
1045104596 8:98879157-98879179 AGTATACAGGAGGATGTGCATGG - Intronic
1047934483 8:129763470-129763492 ATCTTTCAGGAGGAAATACAAGG - Intronic
1048172550 8:132121543-132121565 AGTATTCAGAGGGGTATAGAAGG + Exonic
1048975475 8:139670533-139670555 AGTATACAGAAGGATGTACCTGG + Intronic
1050579803 9:7041293-7041315 AGTATACAGGAGGATATGCATGG + Intronic
1050591992 9:7170246-7170268 AGTATTCAGGAGTAGATCAAAGG + Intergenic
1052126906 9:24787949-24787971 AGTATTCAGCACAATATCCATGG + Intergenic
1052443115 9:28523933-28523955 AAAATTCAGGTGGAAATACAGGG + Intronic
1055474945 9:76653377-76653399 AGTATACAGAAGGATGTGCATGG - Intronic
1186730424 X:12403607-12403629 AGTGATCAAAAGGATATACAGGG - Intronic
1187354755 X:18557458-18557480 AGTATCTACGAGGATATAGAGGG - Intronic
1187361285 X:18629960-18629982 AATATTCAGGAGCATAGAGATGG - Intronic
1188806236 X:34593890-34593912 AGTTTTCAGGATGCGATACAGGG + Intergenic
1189864362 X:45309575-45309597 AGTATTAAGGAGGCTAAAAATGG + Intergenic
1195437448 X:104861720-104861742 AGTACACAGGGAGATATACATGG - Intronic
1195604724 X:106792439-106792461 AGAATACAGGAGGAGAAACATGG - Intronic
1195698921 X:107687399-107687421 AGAACACAGGAGGAAATACAAGG - Intergenic
1196962848 X:121022612-121022634 AGTATACAGGAGGATGTGTATGG - Intergenic
1198431843 X:136575202-136575224 AAGATTCAGGAGGAAATGCAGGG + Intergenic
1198990361 X:142507023-142507045 AGTTTTCAGCAGTATATAGATGG - Intergenic
1199726205 X:150584794-150584816 AGTACACAGGAGGATATGCAAGG - Intronic