ID: 1038962636

View in Genome Browser
Species Human (GRCh38)
Location 8:32538162-32538184
Sequence AATATGCTGAGACCCTCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 148}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038962636_1038962645 4 Left 1038962636 8:32538162-32538184 CCCTCTGAGGGTCTCAGCATATT 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1038962645 8:32538189-32538211 CAGAGATTGGGGGATGGCGGAGG No data
1038962636_1038962644 1 Left 1038962636 8:32538162-32538184 CCCTCTGAGGGTCTCAGCATATT 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1038962644 8:32538186-32538208 AGGCAGAGATTGGGGGATGGCGG No data
1038962636_1038962646 5 Left 1038962636 8:32538162-32538184 CCCTCTGAGGGTCTCAGCATATT 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1038962646 8:32538190-32538212 AGAGATTGGGGGATGGCGGAGGG No data
1038962636_1038962643 -2 Left 1038962636 8:32538162-32538184 CCCTCTGAGGGTCTCAGCATATT 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1038962643 8:32538183-32538205 TTTAGGCAGAGATTGGGGGATGG No data
1038962636_1038962642 -6 Left 1038962636 8:32538162-32538184 CCCTCTGAGGGTCTCAGCATATT 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1038962642 8:32538179-32538201 CATATTTAGGCAGAGATTGGGGG No data
1038962636_1038962639 -9 Left 1038962636 8:32538162-32538184 CCCTCTGAGGGTCTCAGCATATT 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1038962639 8:32538176-32538198 CAGCATATTTAGGCAGAGATTGG No data
1038962636_1038962640 -8 Left 1038962636 8:32538162-32538184 CCCTCTGAGGGTCTCAGCATATT 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1038962640 8:32538177-32538199 AGCATATTTAGGCAGAGATTGGG No data
1038962636_1038962641 -7 Left 1038962636 8:32538162-32538184 CCCTCTGAGGGTCTCAGCATATT 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1038962641 8:32538178-32538200 GCATATTTAGGCAGAGATTGGGG No data
1038962636_1038962647 22 Left 1038962636 8:32538162-32538184 CCCTCTGAGGGTCTCAGCATATT 0: 1
1: 0
2: 2
3: 11
4: 148
Right 1038962647 8:32538207-32538229 GGAGGGAGCTACTGAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038962636 Original CRISPR AATATGCTGAGACCCTCAGA GGG (reversed) Intronic
900410849 1:2511981-2512003 AACATGCTGCGATCCGCAGAAGG + Intronic
902129634 1:14248466-14248488 AATATGGTGAGACTAGCAGAGGG + Intergenic
902988480 1:20170332-20170354 AAGAGACTGAGACCCACAGAGGG - Intronic
906162859 1:43663605-43663627 AAAATGCTGAGACTCAAAGATGG - Intronic
907105057 1:51875352-51875374 AATAAGCTGAGACACTAAGAAGG + Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
912041029 1:105390842-105390864 GATAGGCTGATACCCACAGAGGG + Intergenic
913326151 1:117630519-117630541 AAGATGCTGAGAGCATCAGCAGG + Intergenic
915041437 1:152971279-152971301 AGGGTGCTGAGACCCACAGAAGG + Intronic
916170226 1:161996342-161996364 CATATACTGAGACCCAGAGAAGG + Intronic
920981779 1:210843383-210843405 AATATGCTTAGCTCTTCAGAAGG + Intronic
922966080 1:229692069-229692091 AATATAGTGAGACCCTCTGTCGG - Intergenic
1063499685 10:6542177-6542199 AAGAAGCTGAAACCCACAGAGGG - Intronic
1064367940 10:14725142-14725164 GAAAAGCTGAGACTCTCAGACGG + Intronic
1067471042 10:46537938-46537960 AAAATGCTGTGTCCCTGAGAAGG + Intergenic
1071138080 10:82474900-82474922 AATATGCTGATAATCTTAGAAGG - Intronic
1075169735 10:120102099-120102121 AATGTGCTGAGAGGCTCAGGAGG + Intergenic
1075327806 10:121548536-121548558 AATATGCTAAGAGACTAAGAGGG - Intronic
1075440695 10:122477320-122477342 TATAAGATGAGCCCCTCAGACGG + Intronic
1078034837 11:7792819-7792841 TATATCCTGAGAATCTCAGAAGG - Intergenic
1079291561 11:19192636-19192658 AATAAGCTCAGACACTTAGATGG + Intronic
1084528773 11:69714332-69714354 AAGACACTGAGACCCTCAGGGGG + Intergenic
1087199539 11:95331821-95331843 AAAATGGTGAGTCCCTTAGAAGG + Intergenic
1089686052 11:120147461-120147483 ACTAAGCTGAGACGCACAGAGGG - Intronic
1089841886 11:121425791-121425813 AACATGGTGAAACCCTCACATGG - Intergenic
1089878301 11:121747156-121747178 AATATGGTGAGACCCTGATATGG + Intergenic
1093694393 12:22143786-22143808 ACTCTGCTGACACCCGCAGAGGG + Intronic
1098667431 12:73181058-73181080 ACTCAGCTGACACCCTCAGAGGG - Intergenic
1098875244 12:75860153-75860175 AATCTGCTGAGATCCACACATGG - Intergenic
1099931112 12:89076090-89076112 AAGATGATGAAACCCCCAGATGG + Intergenic
1102084288 12:110123661-110123683 AGTATGCTGAGAGCCTGAAAGGG - Intergenic
1102464873 12:113123407-113123429 ATTAGGCTGAGACCCTCAAGGGG - Intronic
1106872713 13:34038956-34038978 AAGATGCTGAGAACCTGAGTGGG - Intergenic
1122842918 14:104475525-104475547 AAGATACTGAGTACCTCAGAGGG + Intronic
1126716467 15:51523623-51523645 GATACGCAGAGACACTCAGATGG + Intronic
1127873710 15:63094396-63094418 AATATTCTGAGAATCTCAGATGG - Intergenic
1128085287 15:64882226-64882248 AATATTCTGTGACCCCCACAGGG + Intronic
1128654150 15:69447110-69447132 GGAATGCTGAGAGCCTCAGAAGG + Intronic
1129329712 15:74820798-74820820 AGGATGCTGTGACACTCAGATGG - Intronic
1130765934 15:86871280-86871302 TATCTGCAGAGACCCTCAAAAGG + Intronic
1130825596 15:87542227-87542249 AAAATGGTAAGACCCTCTGAAGG - Intergenic
1131350184 15:91692601-91692623 ACTGTGCTGAGACCCTCACTGGG - Intergenic
1133575281 16:7083163-7083185 AATTTGCTGACACCCCCCGAGGG + Intronic
1134045900 16:11100649-11100671 AGAAAGCTGAGACCCTGAGAGGG - Intronic
1138286031 16:55810882-55810904 AATTGGCTGAGACCCAGAGAGGG - Intronic
1139732148 16:68955539-68955561 AAGATGCTGAGACGATCAGTTGG + Intronic
1142099400 16:88263605-88263627 ACTTTGCTGAGAGGCTCAGAAGG + Intergenic
1142665985 17:1464241-1464263 AGTGGGCTGAGACCCCCAGAAGG + Exonic
1142869582 17:2811309-2811331 AGTAAGCTGAGACCCTGAGCAGG + Intronic
1143345351 17:6245076-6245098 AAGATGCTGAGACTTGCAGAGGG - Intergenic
1145984257 17:29034138-29034160 AATATGCTGAGACCCCCAAAGGG + Intronic
1147917435 17:43897048-43897070 AAGATGCTGAGAGCCTGAAATGG - Intronic
1148533710 17:48420209-48420231 AATATGTTAAGATTCTCAGATGG + Intronic
1149382056 17:56104392-56104414 AGAATGCTGAGACCCAGAGAGGG + Intergenic
1149659411 17:58326550-58326572 AAAATCCTGAGACCCAGAGAGGG - Intronic
1151152304 17:72098575-72098597 AAAATGCTGAGATCCAAAGAGGG - Intergenic
1157748250 18:50156267-50156289 AAGATGCTAAGACCCTGATATGG + Intronic
1158115723 18:53993293-53993315 AATCTGATTAGACCCTTAGATGG + Intergenic
1158500268 18:57994546-57994568 TATGTTCTGAGACTCTCAGAAGG - Intergenic
1159846068 18:73461495-73461517 AAGCTGCTCAGACCCTCAGCTGG - Intergenic
1160173135 18:76570987-76571009 CATCAGCTGAGGCCCTCAGAAGG - Intergenic
1167278469 19:48552760-48552782 ATGCTGCTGAGACCCCCAGAGGG + Intronic
1167787378 19:51646988-51647010 AAGATACTGAGGCCCCCAGAGGG + Intergenic
925382188 2:3436634-3436656 AATTTGTTGAAACCCACAGAAGG - Intronic
926933620 2:18065074-18065096 AACAATCTGAGACCCACAGAAGG + Intronic
930398790 2:50856759-50856781 GAAATGCTAACACCCTCAGAGGG - Intronic
930426039 2:51213991-51214013 AAAATACTGAGATCCTGAGAAGG + Intergenic
931982162 2:67705415-67705437 ATTCTCCTGAGACCTTCAGAGGG + Intergenic
935145168 2:100390580-100390602 GACATGCCGAGACCCTCAGCAGG - Intergenic
935796344 2:106644905-106644927 AATTTGCTGTGACCCTCTGTGGG + Intergenic
936616106 2:114049322-114049344 AACTTGCTGAGACCCGGAGAGGG + Intergenic
936619402 2:114079629-114079651 TTTATGCTGAGATACTCAGAAGG - Intergenic
937190158 2:120087734-120087756 AACATGCTGAGAAGCTAAGATGG - Intronic
937817092 2:126263078-126263100 TATAGGCTGAGACCTCCAGAGGG + Intergenic
942768843 2:179490396-179490418 AAAATGCTGAGATCTTTAGAGGG + Intronic
943718920 2:191182482-191182504 AATATGCTGTGAAAGTCAGAGGG - Intergenic
944604626 2:201341006-201341028 AAAATTCTGAGAGCATCAGAAGG - Intronic
946695396 2:222352585-222352607 AATAAGCTGGTACACTCAGAGGG + Intergenic
947153838 2:227140755-227140777 AATTTGCTGAGACTCCAAGATGG + Intronic
1169899332 20:10536813-10536835 AATAAGATTAGACCCTCACATGG - Intronic
1170386728 20:15826836-15826858 AAAATGCTGAGAACTTTAGAAGG - Intronic
1171500520 20:25589321-25589343 AATAGGGTGAGACCCTCTCATGG + Intergenic
1172031540 20:31985361-31985383 GAAATGCTGAGACCGACAGATGG + Intronic
1172883775 20:38218022-38218044 AATATTCTGAATCCCCCAGAGGG - Intronic
1173192173 20:40885064-40885086 AACTTGCTGAGAACCTCAAAAGG - Intergenic
1173478077 20:43377136-43377158 AATTTACTGAGACTCTCAAAAGG - Intergenic
1173658248 20:44715664-44715686 AAGATGCTGAGGCCCAGAGAAGG - Intronic
1175386524 20:58599438-58599460 CATAAGCTGAGACACACAGAAGG - Intergenic
1175910548 20:62403310-62403332 CATCTGCTAAGACCCTCAGGGGG - Intronic
1177850031 21:26334762-26334784 AATCTGCTGAGAGACTCTGATGG - Intergenic
1178776452 21:35555937-35555959 GATATGGTGAGACCCCCAAATGG - Intronic
1180409846 22:12596042-12596064 ATTATGTTGAGACGCTGAGATGG - Intergenic
1181964410 22:26646493-26646515 AAGATGATGGGAGCCTCAGAAGG + Intergenic
1183649964 22:39148161-39148183 AACATGCTGAGGCCACCAGATGG - Intronic
1184089748 22:42286135-42286157 ACTGTGCTGAGACCCTCTGAAGG - Intronic
949100209 3:134236-134258 TATGTGCTAAGACCCCCAGAGGG + Intergenic
950094170 3:10318816-10318838 AAGATTCTCAGACCCTCAAATGG + Intronic
950610307 3:14122702-14122724 ACTAAGCTGAGAGCATCAGATGG - Intronic
951099705 3:18672925-18672947 ATAATGCTCAAACCCTCAGATGG - Intergenic
952071804 3:29646381-29646403 AAGTGGCTGAGACTCTCAGAAGG + Intronic
953545545 3:43861545-43861567 AATAAACTGAGAAGCTCAGATGG + Intergenic
954976577 3:54700945-54700967 AATATGCTGGGACTCTCAGAGGG - Intronic
958856398 3:99391284-99391306 AATATTCTGTAGCCCTCAGATGG + Intergenic
958918509 3:100076432-100076454 CATGTGCTGAGCCCCTCTGATGG + Intronic
959504466 3:107142437-107142459 CATCTGCTGAGACACCCAGAAGG + Intergenic
960147842 3:114221852-114221874 AACATGCTGAGACCCTGAATCGG - Intergenic
960355684 3:116650299-116650321 ACCAGGCGGAGACCCTCAGAAGG - Intronic
963086191 3:141438657-141438679 AGTATGCTGAAAGGCTCAGAGGG - Intronic
969120244 4:4903309-4903331 AATATGCTGCAAACATCAGAAGG + Intergenic
972234421 4:37114347-37114369 TATATGCTGAGACACAGAGAGGG - Intergenic
975665914 4:76735001-76735023 AAGACTCTGAGACCCTGAGATGG + Intronic
978965500 4:114735788-114735810 AATTGGCTGAGACTCTCTGAAGG + Intergenic
981258306 4:142689385-142689407 AATGTGCTGAGACCTTCGTATGG - Intronic
981672545 4:147303465-147303487 CATATGCTGAGACGACCAGAAGG - Intergenic
982648310 4:158051888-158051910 AATATCCAAAGTCCCTCAGAAGG - Intergenic
984511857 4:180688682-180688704 AATATGCTGAGTCTCACAGTGGG + Intergenic
988118870 5:26934031-26934053 CATCTGATGAGAGCCTCAGATGG + Intronic
988407597 5:30843654-30843676 AAGATACTGAGACGCTCAGGGGG + Intergenic
990677278 5:58202083-58202105 AATGTGCTGAGGCCCTTAAAAGG + Intergenic
993316596 5:86414886-86414908 AATATGCTAAAAACCACAGATGG - Intergenic
994242112 5:97435759-97435781 AAAAGGCTGAGACCCACAGATGG - Intergenic
994635049 5:102334452-102334474 CAGATGGTGAGACTCTCAGAAGG + Intergenic
998332893 5:141345291-141345313 ATTAGTCTGAGAGCCTCAGATGG + Exonic
998555048 5:143114984-143115006 AACAGGCTGAGAGCCTCACATGG - Intronic
1000522013 5:162307079-162307101 AATATGCAGTGTCCCTCAAAAGG - Intergenic
1000819186 5:165962127-165962149 TATATGCCAAGACCCTCAGTGGG + Intergenic
1003936699 6:10982202-10982224 AATATGCCCAAATCCTCAGAGGG + Exonic
1004954808 6:20717584-20717606 AATTTGCTGAGACCCTTAATGGG + Intronic
1006246311 6:32739977-32739999 AACATGCTGAGAATCTCAGAAGG + Intergenic
1010328541 6:74593830-74593852 AATGTGCTTATAGCCTCAGATGG + Intergenic
1012421089 6:99066068-99066090 AATATCCTCAGTCCCCCAGATGG - Intergenic
1012738581 6:102982725-102982747 ATTTTGCTGAGACTCTGAGAGGG - Intergenic
1013537387 6:111075804-111075826 GACATGCAGAGCCCCTCAGAAGG + Intergenic
1013977838 6:116097174-116097196 ATTATGCTGAGGCCTTTAGATGG - Intergenic
1017055066 6:150429433-150429455 AATAAGCTGAGGCCCTAAGTGGG + Intergenic
1018706595 6:166467980-166468002 AACATGCTGTGACCCCCTGAGGG + Intronic
1019846603 7:3509143-3509165 AATATTCTGACACCTTAAGATGG - Intronic
1022764524 7:33395890-33395912 AACATGCTGAGAGACTAAGAAGG + Intronic
1023920893 7:44629056-44629078 AATATGCTGAGACCCTAATGAGG - Intronic
1025969551 7:66309502-66309524 AACCTGCTGTGACCCTCAGAGGG - Intronic
1028194087 7:87885171-87885193 AATATGCTTTGAGACTCAGAAGG + Intronic
1029031570 7:97473362-97473384 AATATGATGAGAACCTAAGAAGG + Intergenic
1030861546 7:114637748-114637770 AAAATGGGGTGACCCTCAGAAGG + Intronic
1032486172 7:132289075-132289097 ACCATGCTGAGAGCTTCAGAAGG - Intronic
1038306638 8:26409395-26409417 AATATGCTGAGCTCCTTAAAGGG - Intronic
1038962636 8:32538162-32538184 AATATGCTGAGACCCTCAGAGGG - Intronic
1039147393 8:34464173-34464195 AAAATCCTGAGACTCTAAGACGG + Intergenic
1040306406 8:46214155-46214177 AAAATGCTGGGACCCTCCCAAGG + Intergenic
1040314906 8:46255848-46255870 AAAATGCTGAAAACCTCACAAGG + Intergenic
1043224328 8:77703797-77703819 AAGATGCTGAGATTCTCATAAGG + Intergenic
1044009350 8:86973030-86973052 AAGATGATTACACCCTCAGAAGG - Intronic
1044326649 8:90866314-90866336 AATATGCTGAGCTACTCTGATGG - Intronic
1044889031 8:96812791-96812813 AAAATGCTGAGTCTCTCCGAAGG + Intronic
1047402291 8:124557306-124557328 ATCATGCTGACACCCTCAGGTGG + Intronic
1047734284 8:127752158-127752180 AATATCCTGAGACCCTGCTATGG + Intergenic
1048454879 8:134568860-134568882 AATACTTTGAGACCATCAGATGG + Intronic
1051791423 9:20807261-20807283 AATATGATGATAGCCCCAGAGGG - Intronic
1056225544 9:84491500-84491522 AGTATCCTGAGTCCCTCACATGG + Intergenic
1059102240 9:111483002-111483024 AATAGGCGGTGACCCTCAGATGG - Intronic
1060988937 9:127837333-127837355 AAAATGCTGGGACCCCCAGAAGG - Intronic
1192660598 X:73037947-73037969 AATGTGGTGAAACCCACAGAAGG - Intergenic
1201269433 Y:12240321-12240343 AAAATACTGACAACCTCAGATGG + Intergenic