ID: 1038963888

View in Genome Browser
Species Human (GRCh38)
Location 8:32549920-32549942
Sequence TGCTTCATGAAATGTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038963888_1038963890 18 Left 1038963888 8:32549920-32549942 CCCAACACACATTTCATGAAGCA 0: 1
1: 0
2: 2
3: 22
4: 257
Right 1038963890 8:32549961-32549983 ACTAGTACTTGATAATACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038963888 Original CRISPR TGCTTCATGAAATGTGTGTT GGG (reversed) Intronic
900579465 1:3401430-3401452 TGCTTGTGGGAATGTGTGTTTGG - Intronic
904132804 1:28287849-28287871 TCCTTCTTGAAATGTGAGTTTGG - Intergenic
905123050 1:35696433-35696455 TGCTACATGAAAAGTCTGTTGGG + Intergenic
906817847 1:48897771-48897793 TCCTTTAAGAAATGTCTGTTCGG + Intronic
907810380 1:57863889-57863911 TCATTCATCAAATGTGTATTGGG + Intronic
910955169 1:92695537-92695559 TGCTTGATCTAATCTGTGTTTGG - Intronic
911139818 1:94487331-94487353 GGTTTCATGAAGTGTTTGTTTGG + Intronic
911591823 1:99757159-99757181 TGTTTCATGAAATGTTTGTTGGG - Intronic
911931893 1:103915026-103915048 TGATCCATGAAATGTGAGTATGG - Intergenic
912777454 1:112514738-112514760 AGCTTTATGGAATGTGGGTTAGG + Intronic
913057796 1:115178402-115178424 TGTTTCATGAACTGTGGGTGTGG + Intergenic
913062724 1:115222702-115222724 TGATCCATGAAATGTGTCTCAGG + Intergenic
913415030 1:118595915-118595937 GGCATGATGAAATGTGTGATGGG - Intergenic
915626293 1:157115929-157115951 TGCTTCATAAATGGTGTGATAGG - Intergenic
916341516 1:163741481-163741503 TTCTTCTTGAAATGTTTGGTAGG + Intergenic
917031210 1:170693973-170693995 TGCTTCATGGAATCTCTGTGTGG - Intronic
917961601 1:180149959-180149981 AGCTGCATTAAATGTGTGTGTGG - Intergenic
918441706 1:184574329-184574351 TGTTTCATGAAATGTGCATATGG + Intronic
920263523 1:204705791-204705813 AGCTTCAGGAAATGTGTTTATGG + Intergenic
920503905 1:206502891-206502913 TGCTGCTTGCAATGTGTGATGGG - Intergenic
920760773 1:208781912-208781934 TGCTTCGTGAAATCTTTGCTAGG + Intergenic
922629139 1:227086609-227086631 TCTTTCATGAAATGTCTATTCGG + Intronic
1063285702 10:4685443-4685465 GGCTTCATGGTATGTGTGTGGGG + Intergenic
1065150777 10:22820813-22820835 TTCCTCATCAAATGTTTGTTAGG + Intergenic
1067691328 10:48504135-48504157 GGCCTCATGAAATGTGTGTCAGG + Intronic
1067718495 10:48708327-48708349 GCCTTCAAGGAATGTGTGTTTGG + Intronic
1068026999 10:51658481-51658503 GGATTCATGACATGTTTGTTGGG - Intronic
1068272750 10:54750856-54750878 TGCTTAATTATATTTGTGTTTGG - Intronic
1068506682 10:57909007-57909029 TTTTTCATCAAATGTGTGGTTGG - Intergenic
1068641890 10:59417913-59417935 TTCTTCTTTAAATGTTTGTTAGG - Intergenic
1069638427 10:69939892-69939914 TGCTTCATGGAAAAGGTGTTGGG - Intronic
1069643484 10:69972973-69972995 TTCATCATGGAATGTTTGTTAGG - Intergenic
1070001232 10:72379012-72379034 ATATTCATGAGATGTGTGTTGGG + Intronic
1072758011 10:98033351-98033373 TGCCTCAAGAAAGCTGTGTTTGG - Intergenic
1073168845 10:101483717-101483739 TGTTTCATGAGATTTGTGTTTGG + Intronic
1075216720 10:120542953-120542975 TGCTCCAAGAAATGTGTCATAGG + Intronic
1075361765 10:121843894-121843916 TGTTTCATGAATTGTGCTTTTGG - Intronic
1076257052 10:129035833-129035855 TGGCTCTTGAAATGTGTGTGCGG - Intergenic
1076812421 10:132894868-132894890 TGCTTCTTTAAATGTTTGATGGG - Intronic
1079587280 11:22141725-22141747 TGCCTCATAAAGTGTTTGTTAGG + Intergenic
1080718698 11:34828459-34828481 TCCTTTATCAAATGTGTATTTGG - Intergenic
1082683544 11:56209724-56209746 TACTTTATGATATGTGTATTTGG - Intergenic
1082873039 11:57961367-57961389 TTCATAATGAAGTGTGTGTTTGG + Intergenic
1085098914 11:73783712-73783734 TGCTTCAAGAAAGCTGTTTTTGG + Intergenic
1085813743 11:79712936-79712958 TTCATCATGAAATGTTTGTCAGG + Intergenic
1085996063 11:81915512-81915534 TTTTTAATGAAATGTGTGTGGGG + Intergenic
1086199391 11:84183149-84183171 TTATTCATGAAATGATTGTTAGG - Intronic
1086480965 11:87238265-87238287 TGCTTTATAAAATGTTTATTAGG - Intronic
1087723184 11:101689968-101689990 TGTGCCATGAAGTGTGTGTTTGG - Intronic
1088111890 11:106271390-106271412 AGCTTGATGAAATGTGGGTTTGG + Intergenic
1088122351 11:106385281-106385303 TGCTTTATGTAATTTGTGTTAGG + Intergenic
1088766982 11:112991560-112991582 TTCTTCATGTAAAGTGAGTTGGG - Intronic
1089015982 11:115165878-115165900 TGCTTCGTTAAATTTTTGTTTGG - Intergenic
1091790837 12:3271082-3271104 TGCTTTATGTAATGTTTATTTGG + Intronic
1092600494 12:10056766-10056788 TTCTTCATACAATTTGTGTTTGG - Intronic
1094719758 12:33052292-33052314 TCCCTCATAAAATGCGTGTTGGG - Intergenic
1094885929 12:34871811-34871833 TTCTTCATGTAATGTTTGATAGG + Intergenic
1094896522 12:35044021-35044043 TTCTTCATATAATGTGTGATAGG + Intergenic
1094934390 12:35657252-35657274 TGCTTCATATAATGTTTGATAGG + Intergenic
1094936857 12:35696995-35697017 TGCTTCATATAATGTTTGATAGG + Intergenic
1094938355 12:35721456-35721478 TGCTTCATTTAATGTTTGATAGG + Intergenic
1094943305 12:35801619-35801641 TTCTTCATGTAATGTTTGATAGG + Intergenic
1094948521 12:35886211-35886233 TGCTTCATATAATGTTTGATAGG + Intergenic
1094954528 12:35983363-35983385 TGCTTCATTTAATGTTTGATAGG + Intergenic
1094975397 12:36320013-36320035 TGCTTCATATAATGTTTGATAGG + Intergenic
1094975482 12:36321372-36321394 TTCTTCATGTAATGTTTGATAGG + Intergenic
1094981393 12:36417169-36417191 TGCTTCATATAATGTTTGATAGG + Intergenic
1094982142 12:36429399-36429421 TGCTTCATTTAATGTTTGATAGG + Intergenic
1094988493 12:36532358-36532380 TGCTTCATTTAATGTTTGATAGG + Intergenic
1094995380 12:36643433-36643455 TGCTTCATATAATGTTTGATAGG + Intergenic
1095002301 12:36755697-36755719 TGCTTCATATAATGTTTGATAGG + Intergenic
1095006466 12:36823196-36823218 TTCTTCATGTAATGTTTGATAGG + Intergenic
1095012359 12:36918979-36919001 TTCTTCATGTAATGTTTGATAGG + Intergenic
1095016477 12:36985330-36985352 TTCTTCATGTAATGTTTGATAGG + Intergenic
1095127212 12:38494178-38494200 TACTTGCTGACATGTGTGTTCGG - Intergenic
1095457894 12:42408597-42408619 TGCTTAATAATATGTGTCTTTGG + Intronic
1095668266 12:44828265-44828287 GGCATCATTAAATGTGGGTTTGG - Intronic
1096533789 12:52258228-52258250 TGCTTCACGCACTGTGCGTTGGG + Intronic
1096550174 12:52367044-52367066 TGCTTCACGCACTGTGCGTTGGG + Exonic
1098856682 12:75660727-75660749 TGCTGTATGTAATGTGTGCTAGG - Intergenic
1099149061 12:79085854-79085876 TGCTTCTTGAAATGTCTCTGAGG - Intronic
1100659660 12:96683048-96683070 GGCATCATAAAATGTCTGTTAGG - Intronic
1103942993 12:124510967-124510989 TGCTTCATGGATCTTGTGTTTGG - Intronic
1105295203 13:19083012-19083034 TCTTTCATGGATTGTGTGTTTGG - Intergenic
1107601022 13:42012464-42012486 TGCTTCCTGCAGTGGGTGTTGGG + Intergenic
1107785358 13:43951182-43951204 TGCTTCTTGAAATGAGGTTTAGG - Intergenic
1110885847 13:80634442-80634464 TTCTTCATGCAATGTCTATTAGG + Intergenic
1111002171 13:82198798-82198820 TGCTTCATGGAATGCAAGTTGGG - Intergenic
1111110837 13:83707322-83707344 TGCTTCACAAATTTTGTGTTAGG + Intergenic
1111240886 13:85473224-85473246 TGCTTCATAAAATATGAGTAGGG - Intergenic
1111546793 13:89748575-89748597 TGTATCATCAAATGTGTGATAGG - Intergenic
1112726973 13:102315804-102315826 AGCTTCAATAAATCTGTGTTAGG - Intronic
1114360551 14:21967539-21967561 TGCTTCAGGAAATGTTTGTCTGG + Intergenic
1114412089 14:22510493-22510515 TCCCTCATGAAATGTTTTTTAGG + Intergenic
1115007516 14:28503632-28503654 GGCTTCAGCAAATCTGTGTTAGG + Intergenic
1116555752 14:46304600-46304622 TGCTTTCTGAATTGTGTGTGTGG + Intergenic
1117165963 14:53033886-53033908 AGAATCATGAAATCTGTGTTAGG - Intergenic
1117967547 14:61221257-61221279 TGCTTCATGGAACTTGTCTTTGG + Intronic
1119907426 14:78318581-78318603 TCCTAGATGAAATGTGTGGTTGG - Intronic
1121870441 14:97402190-97402212 TGCTCCATGAAATGTATGAGAGG + Intergenic
1122841999 14:104470174-104470196 TTCCTCGTGAAATGTGTGCTGGG - Intergenic
1125571523 15:40722810-40722832 TCTTTCATGGACTGTGTGTTTGG - Intronic
1130829337 15:87583736-87583758 TCCTTAAAGAAATGTGAGTTTGG + Intergenic
1131105392 15:89730442-89730464 TTCTGCATGAAAAGTGGGTTGGG - Intronic
1131131755 15:89904796-89904818 TGCTCCATGAAATGTGTTCATGG - Intronic
1132791770 16:1694056-1694078 TCCTGCATGAAGTGTGTGTTAGG + Intronic
1133722175 16:8505014-8505036 TGCTTCATGAAAAGTTTATGGGG - Intergenic
1140382367 16:74501683-74501705 TGATTCCTGAAAAGTATGTTTGG + Intronic
1142121275 16:88387801-88387823 TGCTTCAAGAGCTGGGTGTTAGG - Intergenic
1143064363 17:4233266-4233288 TTCTTCACAAAATGTGTGATAGG - Intronic
1143064564 17:4235472-4235494 TTTTTCATGAAATGAGTGTACGG + Intronic
1143266233 17:5640033-5640055 TGCTTCATGACCTGTGTCTCTGG + Intergenic
1145298564 17:21613639-21613661 TGCTCCCTGAAGTGTGTGTGGGG + Intergenic
1153206143 18:2703998-2704020 TTCTTCATGAAATGTGAGAATGG - Intronic
1153221901 18:2868819-2868841 TTCTTCTTTAAATGTCTGTTAGG + Intronic
1153653769 18:7264109-7264131 TGTTTCCTAAAATGTGTTTTAGG - Intergenic
1156585901 18:38430604-38430626 TGCTTCTTGAAATGTGAAATAGG - Intergenic
1156595713 18:38545437-38545459 TGCTGCATGAAATGTGACCTTGG + Intergenic
1156742804 18:40352842-40352864 TAATTCATGATGTGTGTGTTTGG + Intergenic
1157363711 18:47044007-47044029 TGTTTCATGATATGTGTGTTAGG - Intronic
1159175277 18:64825760-64825782 TCCTTCATGATATGTTTCTTAGG - Intergenic
1159730590 18:72022553-72022575 TGATACATGTGATGTGTGTTAGG - Intergenic
1160369251 18:78357823-78357845 TGCTCAATGAAATCTGCGTTTGG - Intergenic
1164227644 19:23260141-23260163 AGTTACATGAACTGTGTGTTGGG + Intergenic
1166695994 19:44851663-44851685 AGCTTCATGAAGTGTGAGCTGGG - Intronic
1166967466 19:46538181-46538203 TGCTTCCTGCAATGTTGGTTGGG - Intronic
930737048 2:54789944-54789966 AGCTTCATGGTATGTGTGTGTGG + Intronic
931996719 2:67845818-67845840 TGCTTAAGAAAATGTCTGTTTGG + Intergenic
935064310 2:99634646-99634668 AGCTTCAAGAAATATGTCTTAGG + Intronic
935202736 2:100871977-100871999 TGCTGCTTGAAATGTGTATTTGG - Intronic
935378115 2:102421393-102421415 TGCTTCATCACATGGGTGGTGGG + Intronic
938127919 2:128687682-128687704 TTCTTCATGAAAAGAGTGTCGGG + Intergenic
938159713 2:128974164-128974186 TGCTTCATCAAATGACTGCTGGG + Intergenic
938201394 2:129375683-129375705 TGCGTCAGGAGCTGTGTGTTTGG - Intergenic
939092597 2:137796849-137796871 TGCTTAATTAAATGTGTGCTTGG + Intergenic
939119339 2:138098153-138098175 AGCTGCATGAAATCTGTGATAGG - Intergenic
939737087 2:145860452-145860474 TGCTTCTTGAAATCTTTGTCAGG - Intergenic
941216662 2:162718530-162718552 TTCTTCATCAAAAATGTGTTGGG + Intronic
941308216 2:163897121-163897143 TGCTTCTGGCACTGTGTGTTTGG + Intergenic
943462069 2:188181411-188181433 TGATGCACGAGATGTGTGTTGGG - Intergenic
943867326 2:192943006-192943028 TCCTTCATTACATGTATGTTAGG + Intergenic
944618978 2:201492599-201492621 TGCTTTCTGAAATGTTTTTTAGG + Exonic
944973280 2:205018797-205018819 TGTTTCATGAAATATTTGCTTGG + Intronic
946498057 2:220216068-220216090 TGGGTCAGGAAATGTGTGTGAGG + Intergenic
947232003 2:227897400-227897422 TGCTTTAGGATATATGTGTTGGG + Intronic
948358460 2:237399488-237399510 TGTTCCATGAAATGTGCTTTGGG - Intronic
1168927999 20:1598736-1598758 TGCTGCATGATATGTGGGCTGGG + Intronic
1169431807 20:5542961-5542983 AGCTTTATGTTATGTGTGTTAGG - Intergenic
1169572394 20:6920720-6920742 TGCTTGATGAAAAGTATGGTAGG + Intergenic
1170085315 20:12524849-12524871 TTTTTCATGAACAGTGTGTTAGG - Intergenic
1170195826 20:13688677-13688699 TGCTTCTAGAAATGTGAGATTGG + Intergenic
1170302049 20:14895184-14895206 AGCTTAAAGGAATGTGTGTTGGG + Intronic
1173240378 20:41290595-41290617 TGCTTCATACAATGTTTGTGAGG - Intronic
1175046933 20:56115686-56115708 AGCTGCATGAAATATATGTTGGG + Intergenic
1179608606 21:42534229-42534251 TGCTTCATGTTATGTTTGTGAGG + Intronic
1184039836 22:41936288-41936310 TGTTTCATGAACTGTGAATTGGG + Intergenic
949104192 3:183621-183643 GCCTTCATGAAATGTCTGTTTGG + Intergenic
949706449 3:6823278-6823300 TGCTTCATAAAATATGACTTTGG + Intronic
949869325 3:8574333-8574355 TGCTTCATGAGATTTGGGTGTGG - Intergenic
950833431 3:15897584-15897606 TGCAGCCTGAAATGTGTGTCTGG - Intergenic
952650750 3:35724235-35724257 TGCCTCCAGAAATGTGTGTTGGG - Intronic
954887307 3:53887048-53887070 GGCTGCAAGAAATGTGGGTTAGG - Intronic
955870632 3:63434704-63434726 GGCTTTAAGAAATGTGTGTTAGG + Intronic
957960445 3:87243570-87243592 TTCTTCCTTAAATGTGTGATAGG + Intronic
958111910 3:89159014-89159036 TGCTTAAGGAAATGTGGGTGAGG - Intronic
958576407 3:95954435-95954457 TACTTCAAGAAATGTGTACTAGG + Intergenic
958708790 3:97691690-97691712 TGCTATATGAATTGGGTGTTAGG - Intronic
959392155 3:105789019-105789041 TGCTTCATATAATGTTGGTTGGG - Intronic
959669494 3:108959943-108959965 TGCTTCATGAAAAGTTTATGGGG + Intronic
959759582 3:109944294-109944316 TGCTTCATGAAATATTGTTTTGG - Intergenic
960355117 3:116642461-116642483 TGCATTATGAAATGTGTAATGGG - Intronic
962037158 3:131664044-131664066 TGCTTGATGAACTTTGTGTAGGG + Intronic
964390285 3:156189498-156189520 TGTTTCATTAAAGGGGTGTTGGG + Intronic
964550204 3:157877208-157877230 TGCAACATGACATGTTTGTTTGG - Intergenic
967502598 3:190217266-190217288 TGAGTCATGAGATGTGAGTTAGG + Intergenic
969042324 4:4308849-4308871 TTCTACCTGAAAGGTGTGTTTGG + Intronic
969269974 4:6092836-6092858 TGCTTCATCTACTGTGTGGTGGG + Intronic
969606398 4:8204314-8204336 TGCTTGGTGAAATGTGAGGTGGG - Intronic
970255816 4:14169557-14169579 TGCTTCAAATAATGTGTATTGGG + Intergenic
971176985 4:24291609-24291631 TGCTTCAATAGCTGTGTGTTTGG - Intergenic
971304940 4:25471737-25471759 TGCTGAATAAACTGTGTGTTGGG + Intergenic
971399204 4:26259898-26259920 TGCTTCATGAAAAGTTTGTGGGG - Intronic
972337997 4:38125587-38125609 TGTTTCATGATGTGTGTGTGTGG + Intronic
973079677 4:45974118-45974140 TGTTCCAAGAAATGTGTCTTAGG - Intergenic
973228591 4:47815899-47815921 CGCTAAATGAAATGTGGGTTTGG - Intronic
974695777 4:65368755-65368777 TGATGCAGGAAATGTGTGTTAGG - Intronic
975660601 4:76685064-76685086 TGCTTTCTCAAATGGGTGTTGGG - Intronic
976659394 4:87523678-87523700 TGTTTCATGAAATGTGAGAAAGG + Intronic
980798821 4:137721149-137721171 TGGTACAATAAATGTGTGTTAGG - Intergenic
981022010 4:140039247-140039269 TGCTTCCTGAAATTTCTGTGAGG - Intronic
981860869 4:149354590-149354612 TGCTTGATGAAATATATGCTTGG - Intergenic
982356092 4:154470772-154470794 TGCTTCATGAATTCTTTCTTTGG - Intronic
983221118 4:165045415-165045437 TGCCTCATAAAATGTCTTTTTGG - Intergenic
983722941 4:170880848-170880870 TTCTTCAAGAAATCTGTGTTTGG + Intergenic
983951341 4:173646360-173646382 TGCTTTAGGAAATTTGTGTTGGG + Intergenic
985993192 5:3580253-3580275 TTCTTGGTGAAATGTGTGGTTGG - Intergenic
987456500 5:18153299-18153321 TGCTTTGTGAACTGTGTTTTAGG + Intergenic
987619204 5:20318557-20318579 TGCTTGTTTAAATGTGTGTGGGG + Intronic
987687380 5:21222781-21222803 TGGTTCATGAAATATGTGGGAGG - Intergenic
988060370 5:26159950-26159972 TGCTTAATGAATTGTGCTTTTGG + Intergenic
988598323 5:32615987-32616009 TGCTTCAGGAAATCTGAGGTAGG - Intergenic
989014251 5:36910889-36910911 TGCTTAGTGAATTGTGTTTTAGG + Intronic
990414389 5:55572173-55572195 TTCTTCCTGTAGTGTGTGTTAGG + Intergenic
990484611 5:56245708-56245730 TGCTTCATGAAATGAGGTATGGG - Intergenic
990904862 5:60793003-60793025 TGCTCCATGAAAAGTTTGTGTGG - Intronic
992004695 5:72465896-72465918 TCATTCATGAAATGGGAGTTAGG + Intronic
992480120 5:77142932-77142954 TCATTAAGGAAATGTGTGTTTGG + Intergenic
992971687 5:82066605-82066627 TGCTTCAGGAAATTTATGATAGG - Intronic
993508246 5:88737906-88737928 AGCTTTATTAAATTTGTGTTAGG + Intronic
993880240 5:93352650-93352672 GGCTTCCTGAAATTTTTGTTTGG + Intergenic
993992788 5:94680549-94680571 TCCTTAATGAAATTTGAGTTTGG + Intronic
994515540 5:100768359-100768381 TGCTAGATGAAATGTGAGATAGG + Intergenic
994747109 5:103691980-103692002 TGTTCCATAAACTGTGTGTTGGG + Intergenic
994841814 5:104933564-104933586 TCCTTTATCAGATGTGTGTTTGG - Intergenic
995646108 5:114313877-114313899 TGCTTCATGAAATGTTTTTACGG + Intergenic
996303502 5:122017881-122017903 TGCTTTATTAAATGTGTATTGGG + Intronic
996325172 5:122264865-122264887 TGCTACTTGAAATGTGTCTGTGG - Intergenic
996826622 5:127689317-127689339 TGATTCATGAATTGAGGGTTGGG + Intergenic
998257173 5:140596906-140596928 TACTTCATGTAATTTGTGTGAGG + Intergenic
998619144 5:143775100-143775122 TGCATCAGGAAAAGTGAGTTGGG + Intergenic
998640173 5:144001022-144001044 TGCTTCATGAAAAGTTTATGGGG - Intergenic
999800724 5:155031489-155031511 TGCTTCCTTAAATGTTTGGTGGG + Intergenic
1000947679 5:167441484-167441506 TGCTTCATTAAATGTAATTTGGG + Intronic
1001155229 5:169266902-169266924 TGCTTAAGGTAATATGTGTTAGG - Intronic
1001163500 5:169342262-169342284 TGCATTGTGAAATGTGAGTTGGG - Intergenic
1001308335 5:170592477-170592499 GGTTTCATGAAATGTGCGTTAGG - Intronic
1001316752 5:170647971-170647993 TCCTTGGTGAAATGTCTGTTCGG - Intronic
1001750868 5:174130338-174130360 TGCTACATGAATTGAGAGTTTGG - Intronic
1003792909 6:9567063-9567085 TGCTTCATGTAATTTGTGTGTGG - Intergenic
1006992201 6:38224817-38224839 TGTTTCAGAATATGTGTGTTAGG + Intronic
1007066820 6:38999044-38999066 TGCATAGTAAAATGTGTGTTGGG + Intronic
1007349390 6:41257912-41257934 TCCCTGGTGAAATGTGTGTTTGG - Intergenic
1008362702 6:50640567-50640589 TGCTTCATGGACTGGCTGTTAGG - Intergenic
1009774577 6:68189573-68189595 TGATTCCTGAAGTGTGTTTTGGG - Intergenic
1012126228 6:95431577-95431599 TGCTTCATAAAATGTTTCTAAGG - Intergenic
1013832320 6:114288943-114288965 TGCTTTATGAACTTTGTATTTGG + Intronic
1015234959 6:130960170-130960192 TGCATTATGAAGTGTGTGTGAGG - Intronic
1015343107 6:132125024-132125046 TGTTTTATGAATTGTGTGTGGGG + Intergenic
1016020410 6:139231147-139231169 GGTTTTATGAAATGTGTGTGTGG - Intergenic
1018959652 6:168439263-168439285 TGCTACATGAAAGACGTGTTGGG + Intergenic
1018993073 6:168688963-168688985 TGCCTAATGAAACGTGTGTGAGG + Intergenic
1020436359 7:8166578-8166600 TTCGTCATGAAATCTTTGTTAGG - Intronic
1020512190 7:9071124-9071146 TGCTTTCTGAATTGTTTGTTTGG + Intergenic
1020907443 7:14081031-14081053 TGCTTTATGAAAAGTTTTTTGGG - Intergenic
1021202583 7:17742353-17742375 TGCTTCATATAAAGTGTGTGGGG - Intergenic
1024617874 7:51130738-51130760 TTCTTGATGAAACGTGTCTTTGG + Intronic
1025118560 7:56279328-56279350 TGCTACATGAAATTTCAGTTAGG - Intergenic
1025823389 7:64992138-64992160 TGCTTCATGTTATGTCTGTGGGG - Exonic
1026202508 7:68226453-68226475 TGCTACATGAAATTTCAGTTAGG - Intergenic
1028119252 7:87039318-87039340 TTCTTCTTGAAATGTTTGGTAGG - Intronic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1030290850 7:107871287-107871309 TGCTTCATTACTTGTGTCTTTGG - Intergenic
1033023266 7:137748749-137748771 TGCATCATGATCTGTGTGATGGG - Intronic
1034842051 7:154407559-154407581 TGGATCATGAAAGATGTGTTTGG + Intronic
1035445026 7:158935220-158935242 TGCTGCAGGAAATGTGTGTGTGG + Intronic
1037914477 8:22764596-22764618 TTCATCTTGGAATGTGTGTTTGG + Intronic
1038896390 8:31787139-31787161 GGCTTCATGAAATACATGTTTGG - Intronic
1038963888 8:32549920-32549942 TGCTTCATGAAATGTGTGTTGGG - Intronic
1039825565 8:41171311-41171333 TGCTTAATGCAATGGGTTTTAGG - Intergenic
1043965359 8:86468941-86468963 TTCCTCATGAACTGTGTTTTGGG - Intronic
1044089331 8:87979604-87979626 TGCTTCCTGAAATGTGAAGTTGG - Intergenic
1044375529 8:91465692-91465714 TGCTTTATGAAAGGTGGGTGGGG - Intergenic
1045895453 8:107210572-107210594 TGCTTTATGAAATGTTTATGGGG + Intergenic
1046101664 8:109621520-109621542 TGCTTCATATGGTGTGTGTTGGG + Intronic
1047330308 8:123880883-123880905 TGGATCCTGATATGTGTGTTAGG - Intronic
1048137772 8:131762863-131762885 TGCAGCATGAAGTGTGTGTCAGG - Intergenic
1048777854 8:137967423-137967445 TGCTTCATGCCATGTCTTTTAGG + Intergenic
1050876706 9:10648075-10648097 TGCATTATGAAATGTTTGATAGG + Intergenic
1051227432 9:14916032-14916054 TGCTTTATGAAAAGTTTGTGGGG + Intergenic
1055047710 9:71947358-71947380 TTATTCATGAAAGGTGGGTTAGG + Intronic
1055752927 9:79527376-79527398 AGCATCATGAAGTGAGTGTTGGG + Intergenic
1057380517 9:94563232-94563254 TGCTTCATGGCATGTCTGTGTGG - Intronic
1058910026 9:109512488-109512510 TACGTCAAGAAATGTTTGTTAGG + Intergenic
1059281664 9:113139334-113139356 TGTTTTATGAAAAGTCTGTTTGG - Intergenic
1187731624 X:22261135-22261157 TGCTTCAATAAATATTTGTTCGG - Intergenic
1189660364 X:43290674-43290696 TGCTTTATGAAAAGTTTGTGGGG - Intergenic
1192384540 X:70653278-70653300 TCCTTCATTACATATGTGTTTGG - Intronic
1192466506 X:71360367-71360389 TGCTTCATGAAAAGTTTATGGGG - Intergenic
1193950967 X:87797788-87797810 TACTTCATGAACTGTATGTAAGG + Intergenic
1194682067 X:96866387-96866409 TGCTATATGAAATATGTCTTTGG - Intronic
1195826670 X:109009616-109009638 TCCTTAATGAATTGTGTATTTGG - Intergenic
1197150645 X:123216805-123216827 TTCTTCGAGAAATGTGTGTAGGG + Intronic