ID: 1038966858

View in Genome Browser
Species Human (GRCh38)
Location 8:32583297-32583319
Sequence CATCTTGAGCAGAAAAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 290}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038966858 Original CRISPR CATCTTGAGCAGAAAAAGGA GGG (reversed) Intronic
900059125 1:664871-664893 AATCTTGATCAAAAAAAGCAAGG - Intergenic
901039175 1:6354022-6354044 CAGCTGGAACAGAAAAAGGGTGG - Intronic
903651770 1:24926942-24926964 GACCTTGAGCAGCAGAAGGAAGG - Intronic
903735850 1:25529674-25529696 CCACTGGAGCAGAAGAAGGAAGG + Intergenic
903770518 1:25760911-25760933 CAGCTGGAGCAGAAAGAGGCTGG - Intronic
903816183 1:26066171-26066193 GATCCTGAGCAGATGAAGGAGGG + Intronic
904026313 1:27505741-27505763 CACCTTCAGAAGAAAAAAGACGG + Intergenic
906258738 1:44369954-44369976 CATTTTGAGTAGAGAAAGCAAGG - Intergenic
906271645 1:44484049-44484071 CAGCTTGTGAAGAACAAGGAAGG - Intronic
906566003 1:46801540-46801562 CAGGTTGAGCAGACAAAGGCTGG + Intronic
907560200 1:55380993-55381015 ACTCTAGAGCAGAAAAAGAATGG - Intergenic
907978479 1:59456990-59457012 CATATTCAGCAGAGAAAGGCTGG + Exonic
909219826 1:72942816-72942838 AATCTTCAGCAGAGATAGGATGG - Intergenic
909782453 1:79563413-79563435 TATCTTAAGCAAAAAGAGGAAGG + Intergenic
909795318 1:79728368-79728390 CAACTTGAGCAGTAAAAGCAAGG - Intergenic
909822517 1:80084243-80084265 GCTCTTGAGCAGAAAAAAGAAGG + Intergenic
912688346 1:111784854-111784876 CATCTTTAGCAGCGAGAGGAAGG + Intronic
913999980 1:143685638-143685660 CATCTTTAACAGATAATGGAAGG + Intergenic
914919810 1:151839180-151839202 CTATTTGAGCAGAAAAAGAAAGG + Exonic
914999998 1:152580230-152580252 CAGCCTGAGTAGAAAGAGGATGG + Intronic
915899144 1:159834022-159834044 CTTCTTGAGAAGAGGAAGGAAGG + Intronic
915962473 1:160278762-160278784 CAGCTTGAGCTCAAAAAGGTTGG + Exonic
917967951 1:180190384-180190406 CATATGGAGAAGGAAAAGGATGG - Intronic
919136706 1:193518353-193518375 CATCTTGAGCAAAGAAGGCAGGG + Intergenic
919364676 1:196642506-196642528 CATTATGCTCAGAAAAAGGATGG - Intergenic
919517407 1:198543901-198543923 CAACGTGAGCAAAAGAAGGAAGG - Intergenic
919800357 1:201350469-201350491 CATGCTGAGCAGGAGAAGGAGGG - Intergenic
920025094 1:202988379-202988401 TATTTTGGCCAGAAAAAGGAAGG - Intergenic
920595709 1:207267826-207267848 CACCTTGAGCATAAAATGTAAGG + Intergenic
921190654 1:212705219-212705241 CATTTAGAGATGAAAAAGGATGG - Intergenic
1064144128 10:12814207-12814229 CATTTTCATCATAAAAAGGAGGG - Exonic
1064739201 10:18414854-18414876 CATCTGGTGGAGAAAAAGGGAGG - Intronic
1065036093 10:21639898-21639920 TGTCTTGGGGAGAAAAAGGAGGG + Intronic
1065559476 10:26947722-26947744 CATATTTAGCAAAAAAAAGAAGG - Intergenic
1065664936 10:28048968-28048990 CATCTCAAGCAGAAAGATGAGGG + Intergenic
1068824990 10:61426780-61426802 CCTCTTGAGCCTAAAAGGGAAGG + Intronic
1068869379 10:61927154-61927176 TCTCTTGAGCAGAAAATGAAGGG - Intronic
1070836439 10:79449947-79449969 TATCTTGAGCAGCAAAGGGTGGG + Intergenic
1071242486 10:83723327-83723349 CAGCTAGAGTAGAAAAAGGGAGG + Intergenic
1071325136 10:84507467-84507489 CATTTTAACCATAAAAAGGAAGG - Intronic
1073568365 10:104555053-104555075 CATTTTGAGCAAAAAATGGCTGG - Intergenic
1074540465 10:114361316-114361338 CAACATGAGCAGAAAAAGGTGGG + Intronic
1075102926 10:119518708-119518730 CATCTTGAAAAAAAAAAAGAGGG - Intronic
1075846519 10:125549314-125549336 CATCTTTTGCAGAAAAGGGATGG + Intergenic
1077831326 11:5874439-5874461 CCTCATGAGGAGAAAAATGATGG - Intronic
1079077985 11:17395532-17395554 GATCTGGAGCACAAAGAGGAGGG - Intronic
1080338699 11:31231253-31231275 AAAGTTGAGGAGAAAAAGGAAGG - Intronic
1081569947 11:44284106-44284128 CATTTTGATCAAAAAGAGGAAGG + Intronic
1081678102 11:44982771-44982793 GACCTGGAGCAGAGAAAGGAAGG - Intergenic
1082827481 11:57591019-57591041 CAAGTTGGGCAGAACAAGGAGGG + Intergenic
1085642961 11:78204683-78204705 TATCATGAACAGAAAAAAGAAGG + Intronic
1086438756 11:86807384-86807406 CATCTTAAACATAGAAAGGAAGG + Intronic
1087252409 11:95917782-95917804 CATGCTGAGGAGGAAAAGGAGGG + Intronic
1087919205 11:103846874-103846896 CATCTTGAGCACAAAATTTAAGG - Intergenic
1088278215 11:108111451-108111473 CATGTTTAGCAGAGAAGGGAAGG - Intergenic
1089479189 11:118791350-118791372 CTTCCTGAGGAGAAAATGGAGGG + Intergenic
1089498669 11:118920436-118920458 CAGCCTGAGCAGAAGACGGAGGG - Intronic
1089588108 11:119522753-119522775 CATCTGGAGCAGGGGAAGGAAGG - Intergenic
1090421404 11:126577786-126577808 CGTCTAGACCAGAGAAAGGACGG - Intronic
1090770441 11:129915010-129915032 CATCTTGGTCTGAAAAAGCAAGG + Exonic
1091229240 11:133977148-133977170 CCACTTGAGCAGAAAGGGGAGGG + Intergenic
1093066142 12:14660371-14660393 CAAGTTGAGCAGAAAAATCATGG + Intronic
1093707261 12:22288275-22288297 CATCTTTAGCTGAAAGGGGACGG + Intronic
1095183742 12:39177585-39177607 TATCTTGAGCAAAATAATGAAGG + Intergenic
1095486766 12:42693272-42693294 TCTCTTGAGCTGAAGAAGGAAGG + Intergenic
1096684439 12:53278593-53278615 CATCTTGAAAAAAAAAAAGAAGG - Intronic
1096873344 12:54608597-54608619 GGTATTGAGCAGGAAAAGGAAGG - Intergenic
1098411528 12:70189356-70189378 CAACATGAGCAGCAAAATGAAGG - Intergenic
1098719217 12:73874048-73874070 TAACCTGAGCAAAAAAAGGAAGG - Intergenic
1099772975 12:87086843-87086865 CATTTTAAGAAGAAACAGGAAGG + Intergenic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1100700256 12:97139755-97139777 CAGCTTGATGAGATAAAGGAAGG - Intergenic
1101168577 12:102064045-102064067 GATCTAGAGCAGAGAAATGATGG + Intergenic
1108231529 13:48348497-48348519 CACTGTGAGCAGAAAAATGAAGG - Intronic
1110322158 13:74172872-74172894 GATGTTGATCAGAAAAAGGGTGG - Intergenic
1110591948 13:77273535-77273557 CTTCTTGGGGAGAAACAGGAAGG - Exonic
1111608701 13:90576064-90576086 GATCTTGAGAAGAAATGGGAAGG - Intergenic
1112309984 13:98309675-98309697 CATATTTGGCAGAACAAGGAAGG + Intronic
1113406150 13:110042482-110042504 AATCTTGAGGAAAAAAACGAAGG + Intergenic
1115339714 14:32280172-32280194 CATCTTGAAGAAAAAAGGGAAGG - Intergenic
1117100022 14:52335919-52335941 CAGCTTGAGCAGGAAGAGGGAGG + Intergenic
1118036361 14:61872593-61872615 TCTCTTGAGAAGAAACAGGAAGG - Intergenic
1118075030 14:62288837-62288859 AATGTTGAGCAGGGAAAGGAAGG + Intergenic
1118390547 14:65291839-65291861 GGTCTTGGGCAGGAAAAGGAAGG - Intergenic
1118856844 14:69629651-69629673 CAACTTGAACAGAAACAAGAGGG - Intronic
1120864070 14:89280558-89280580 AAACTTGAGCTGAAAAAGGAGGG - Intronic
1120981062 14:90289547-90289569 CATTTCTAGCAGAAACAGGAGGG + Intronic
1121021345 14:90582057-90582079 CCTTTTGAGCTGAAAACGGAGGG - Intronic
1121067846 14:90985442-90985464 CAAGTTGAGCACAACAAGGAAGG - Intronic
1122354554 14:101115064-101115086 CAGATTGAGCAGGAAAGGGAAGG - Intergenic
1125399408 15:39284201-39284223 CAGGTTTAGCAGAAAAAGTATGG + Intergenic
1126033655 15:44526230-44526252 CTGTTTGAGCATAAAAAGGAAGG - Exonic
1127314912 15:57785677-57785699 TATCTTGAGTTAAAAAAGGAAGG - Intergenic
1129148483 15:73671296-73671318 CTTCTTAAGAAGAAAAGGGAGGG - Intergenic
1132444326 15:101898129-101898151 AATCTTGATCAAAAAAAGCAAGG + Intergenic
1132473549 16:120411-120433 CATGTTGTGATGAAAAAGGAAGG + Intronic
1132867266 16:2099656-2099678 CATCCGGAAGAGAAAAAGGATGG + Exonic
1133109814 16:3541345-3541367 CTTCTTGAGAAGATAAAGAAGGG + Intronic
1133650480 16:7808136-7808158 CAAATTGAGCAGAAAAAGAGAGG + Intergenic
1135663191 16:24314476-24314498 CACCTTGATGTGAAAAAGGAAGG + Intronic
1135752736 16:25069847-25069869 GATATTTAGGAGAAAAAGGAGGG + Intergenic
1137377098 16:47961561-47961583 AGTCATGAGCAGAAAATGGAGGG + Intergenic
1137770642 16:51013566-51013588 CATTTTGTGCAGAATAAGTAAGG + Intergenic
1138398825 16:56729637-56729659 CATCTTGAGCTGAATAAAGAAGG - Intronic
1138443808 16:57050642-57050664 CATCTAGAGCAGAGACAGCAAGG + Intronic
1139134568 16:64186376-64186398 AATCTTTTGCAGAAAATGGATGG - Intergenic
1140233422 16:73137251-73137273 AATCTGGTGCAGAAAAAGAAAGG - Intronic
1141377933 16:83548809-83548831 CCTCTAGGGCAGAAAAAAGAGGG - Intronic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1144432646 17:15209184-15209206 CATATATAGCAGAAAAAGGGAGG + Intergenic
1144806489 17:17971746-17971768 CACCTCTAGCAGCAAAAGGAAGG + Intronic
1145754072 17:27377494-27377516 CATCACAAGAAGAAAAAGGATGG + Intergenic
1150333858 17:64315987-64316009 GAACTAGAGGAGAAAAAGGAAGG + Intergenic
1150853102 17:68724660-68724682 CATGTTGAGTAGACAGAGGAGGG + Intergenic
1152104282 17:78319562-78319584 CAGCTGGAGCAGAGAAGGGAAGG - Intergenic
1153018132 18:602753-602775 CATCTTGAGCTGAACACTGAAGG + Intronic
1153227496 18:2909671-2909693 CTCCTGGAGCAGAGAAAGGATGG - Exonic
1153764199 18:8359819-8359841 GCTCGTGAGCAGAACAAGGAAGG - Intronic
1155481035 18:26287867-26287889 ACTCTTGAGCAGATAAATGATGG + Intronic
1156006792 18:32451681-32451703 CATTTAGAGCAGAAAAAGTTTGG - Intronic
1156017850 18:32566505-32566527 TATGATGAGCAGAAAAATGATGG + Intergenic
1156263207 18:35463539-35463561 CAGCTTGAGCAGGAAAAGGAGGG - Intronic
1156620229 18:38842904-38842926 AACCTTCAGCAGAAAGAGGATGG - Intergenic
1157146769 18:45171341-45171363 GATCTTTAGAGGAAAAAGGAAGG + Intergenic
1158965237 18:62616742-62616764 CATCAGGAGCAGGAAAAGCAAGG + Intergenic
1158993976 18:62898414-62898436 CACAGTGAGAAGAAAAAGGAAGG - Intronic
1159424679 18:68270065-68270087 CATCTTAAGCATTAAATGGAAGG + Intergenic
1159439311 18:68456798-68456820 CAACTTGAACAGAAACTGGAGGG + Intergenic
1159773631 18:72578543-72578565 CATACTTAGTAGAAAAAGGAGGG - Intronic
1159814777 18:73059288-73059310 CACCTTGATCAGAACAAAGATGG - Intergenic
1163346597 19:16746879-16746901 CACCTTGAGTAGGAAGAGGAGGG + Intronic
1166688626 19:44810101-44810123 CAGATTGAGCAGAGAAGGGAAGG + Intronic
926609924 2:14936461-14936483 CATCTGGGGCAGAACAAAGAAGG + Intergenic
926808422 2:16734749-16734771 CATCTTGGGTAGAGAAAGAAGGG - Intergenic
927007118 2:18862185-18862207 CATGTAGAACAGAAACAGGAAGG + Intergenic
927841003 2:26444050-26444072 CATTTTGATCAACAAAAGGAAGG - Intronic
928667672 2:33566949-33566971 TATCACGAACAGAAAAAGGAGGG + Intergenic
928729230 2:34211432-34211454 AAGGTTGAGGAGAAAAAGGAAGG + Intergenic
929823944 2:45295505-45295527 CATCGTAGGCAGAGAAAGGAGGG + Intergenic
931512045 2:63009415-63009437 CATGCTGAGAAGAAAAAGGAAGG + Intronic
931859106 2:66335004-66335026 CATTATGAAAAGAAAAAGGAGGG + Intergenic
931883111 2:66587554-66587576 AATCTAGAGCAGAGCAAGGAAGG + Intergenic
933007199 2:77010704-77010726 CATCCTGGGCAGAGAAAAGAAGG - Intronic
933452158 2:82468299-82468321 CATCGTGAGCCAAAAAAGAAAGG - Intergenic
937769433 2:125702524-125702546 CATATTTTGCAGAAAAAGAAAGG - Intergenic
938795320 2:134713914-134713936 ACTATAGAGCAGAAAAAGGAGGG - Intronic
940009862 2:149041336-149041358 CATCCAAAGCAGAAAAAAGAAGG + Intronic
940196959 2:151105478-151105500 CTTCTTGAGCAGAAAATGATAGG - Intergenic
941786162 2:169500811-169500833 CATGTTGGGAAGAAAAAGAAAGG - Intronic
942792725 2:179779340-179779362 CATCTAGAGCAGAGAGAGCAGGG + Intronic
943903415 2:193470031-193470053 CATCTTGAGAAAAAAAAGTTAGG - Intergenic
945363152 2:208916771-208916793 CATCTTGTGTAGAATGAGGAAGG - Intergenic
945606881 2:211944587-211944609 CATCTTGCAGAGAGAAAGGAAGG - Intronic
947375723 2:229493017-229493039 CTTCTTGAGGTGAAAAAGGCTGG + Intronic
947701161 2:232235155-232235177 CATTTAGAGCAGAGAGAGGAAGG - Intronic
947902130 2:233729798-233729820 CATAAGGAGCAGAAAAAGCATGG - Exonic
1169033802 20:2433318-2433340 AATCTTAAGAAGATAAAGGAAGG + Intergenic
1170666454 20:18390897-18390919 CTTCTTTAGAAAAAAAAGGAGGG + Intronic
1170839202 20:19909918-19909940 AGTCTTGAGCAGGAAAAGGTGGG + Intronic
1172248813 20:33464586-33464608 CATCTTGAAAGGAAGAAGGAAGG + Intergenic
1174316006 20:49702328-49702350 CTTCATGGGCAGAAAAAGAATGG + Intronic
1174903810 20:54528505-54528527 CTTCATGACCAGAAAAAGGAGGG + Intronic
1175321531 20:58091756-58091778 CCTCTTTAGCATAAAATGGATGG - Intergenic
1178016881 21:28357194-28357216 CATGTTGAGTAGAAACAGGCTGG + Intergenic
1178840441 21:36134146-36134168 GATCTTTAGGAGAAAAAAGAAGG + Intergenic
1182782789 22:32881254-32881276 CATTTTGAGATGAAAAATGATGG + Intronic
1184207282 22:43013559-43013581 CATCTTGGGCAAGAACAGGAGGG + Intronic
1184272636 22:43393389-43393411 CCTCTTCAGCAGAAAGAGGCCGG - Intergenic
952217391 3:31290990-31291012 CTTATTGAGCAGAAAAGGAATGG - Intergenic
953202409 3:40789308-40789330 CATCTTGCCCAGAATAAGGCTGG - Intergenic
953584372 3:44186547-44186569 CATTTTGGTCAGAAAAATGAAGG + Intergenic
955659342 3:61279695-61279717 CATTTAGAGCAAAAAAAGAATGG + Intergenic
956260495 3:67335550-67335572 CATTTTGAGTGGAAAATGGAGGG + Intergenic
956309997 3:67868658-67868680 CATCTGGAGGAGAAAACAGAAGG - Intergenic
957245616 3:77712267-77712289 CATCATGAGGGGAAAGAGGAGGG - Intergenic
960690816 3:120344616-120344638 CATCATGAACAGAAAAAGGAAGG + Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
963766700 3:149343578-149343600 TATCTCAAGCAGAGAAAGGAAGG + Intergenic
964032579 3:152154037-152154059 CATCTCAAAAAGAAAAAGGAAGG + Intergenic
965956809 3:174379982-174380004 GATTTTAAGCAGAAAAAGGAAGG + Intergenic
966021683 3:175220545-175220567 CATCTTAAGAAGAAAAAGCAAGG - Intronic
966035710 3:175412214-175412236 CATCCTTAGCATAAAAAGGGGGG - Intronic
967910849 3:194541485-194541507 CACCTTGGGAAGAGAAAGGAAGG - Intergenic
971619034 4:28830073-28830095 AATCTCTAGCAGAATAAGGAGGG + Intergenic
973085768 4:46057978-46058000 CTTCATTAGCAGAAAAAAGAAGG + Intronic
973345703 4:49052515-49052537 CATCTCAATCAGCAAAAGGAGGG - Intronic
974611762 4:64227433-64227455 TTTCCTCAGCAGAAAAAGGAGGG - Intergenic
975185697 4:71399627-71399649 AATCTAGAGTAGAAAAATGAGGG - Intronic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
980727021 4:136776134-136776156 CTTTTTGAGCAGAAATATGATGG + Intergenic
983762600 4:171430702-171430724 CATTTTGAACAAGAAAAGGATGG - Intergenic
984624073 4:181986262-181986284 GATCTTCAAGAGAAAAAGGAAGG - Intergenic
985346922 4:189015879-189015901 GATATTGAGCTGACAAAGGAGGG + Intergenic
986999467 5:13645119-13645141 CATGTTAAGTAGAGAAAGGAGGG + Intergenic
987581509 5:19799902-19799924 CATCTTGAACAGAAAAACTGGGG - Intronic
988857497 5:35243184-35243206 CATCTGATGCAGAAAAAAGAAGG + Intergenic
989470365 5:41810161-41810183 GATCTTGAGAACAATAAGGAAGG + Intronic
989726293 5:44590409-44590431 CATCTTAAGTGCAAAAAGGAAGG + Intergenic
990308521 5:54517282-54517304 CTCCTTGAGCAGAAGAGGGAAGG + Intergenic
990848512 5:60173789-60173811 CATCTTGGGGAGAAAAAATAAGG + Intronic
991361033 5:65820537-65820559 CATTTTGACCAAAGAAAGGAAGG + Intronic
991975539 5:72180636-72180658 CAGTTTGAGCAGACAAAGAACGG - Intronic
992271502 5:75068883-75068905 AAACATCAGCAGAAAAAGGATGG + Intronic
993977347 5:94498604-94498626 CTTCTTATGCAGAAAAGGGAAGG - Intronic
995226739 5:109709022-109709044 CACTTTGAGTAGATAAAGGATGG + Intronic
996927902 5:128850488-128850510 GATCTGGAACAGAACAAGGATGG + Intronic
997752695 5:136363279-136363301 CAATTTCAACAGAAAAAGGAAGG - Intronic
997949599 5:138231589-138231611 CATCTTGAGCTGGAAAATGCAGG + Intergenic
998535247 5:142924255-142924277 CATCTTAAGGAGAAGAAGAAAGG - Intronic
999828042 5:155292830-155292852 CATGTTGAGCAGAAATGGCAAGG + Intergenic
1001864319 5:175090155-175090177 CATCTTGGGCAGGAGATGGAAGG - Intergenic
1003124817 6:3347872-3347894 CATCTTTAGCAGTAGAAGGAAGG - Intronic
1003558250 6:7159623-7159645 CATCTTTACAAGAAAAGGGAAGG + Intronic
1003838539 6:10096452-10096474 CATTTTAAGCTGAAAAATGAAGG + Intronic
1005929051 6:30467149-30467171 AATCTTCAGCAGAAAATGGAAGG + Intergenic
1005931339 6:30486956-30486978 AATATTGAGTTGAAAAAGGAAGG - Intergenic
1006256280 6:32835199-32835221 CATGTGCAGCAGAGAAAGGAGGG + Exonic
1006613960 6:35312282-35312304 CACCTGGAGCAGGAGAAGGAAGG - Exonic
1006918836 6:37614478-37614500 CATCTTCAGCAGAAAGATCAAGG - Intergenic
1008372730 6:50753300-50753322 TGTTTTGAGCATAAAAAGGATGG - Intronic
1009860383 6:69322481-69322503 GAGGTTGTGCAGAAAAAGGAAGG - Intronic
1010505155 6:76648175-76648197 CATTTTCAGTAGAAAAAGGATGG + Intergenic
1011057033 6:83216441-83216463 CATATTTAGCAAGAAAAGGAAGG + Intronic
1011836311 6:91435745-91435767 CTCCTTGAGCACAGAAAGGAAGG + Intergenic
1012340987 6:98122982-98123004 CATTTTGAAAAGAAAGAGGAAGG - Intergenic
1012565943 6:100651862-100651884 GATCTTTAGCAGCAAAAAGATGG + Intronic
1012910190 6:105109371-105109393 CATATTGAGCAGAAAGTGGAGGG + Intronic
1013073311 6:106748751-106748773 GATCTTCAGCAGAAAACTGATGG - Intergenic
1013337093 6:109174613-109174635 CTTTTTGAGGAGAAAAAAGATGG + Intergenic
1014228237 6:118872793-118872815 CATCTTAGGGAAAAAAAGGAAGG + Intronic
1015455679 6:133424379-133424401 ATTCTTGAGCAGAAGGAGGAGGG - Intronic
1016114526 6:140263401-140263423 GAACATGAGCAGAAGAAGGAGGG - Intergenic
1018781964 6:167076250-167076272 CATTTGAAGCAAAAAAAGGAAGG - Intergenic
1018815960 6:167331037-167331059 CAACTTGTGCAGGAACAGGAAGG - Intronic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020425203 7:8057717-8057739 CAGATTAAGAAGAAAAAGGAAGG - Intronic
1022949413 7:35321466-35321488 TATGTTGAGGAGAAAAAGTAGGG + Intergenic
1023856546 7:44187694-44187716 CACGTGGAGCAGATAAAGGATGG + Intronic
1025108009 7:56189041-56189063 AAATTGGAGCAGAAAAAGGAGGG - Intergenic
1025108424 7:56192449-56192471 TATCTAGAGGAGAGAAAGGAAGG - Intergenic
1026227140 7:68452384-68452406 ATTCTTGCGCAGAAGAAGGAAGG - Intergenic
1026309841 7:69173951-69173973 TATCTAGAGGAGAGAAAGGAAGG + Intergenic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1027647069 7:80814993-80815015 AATCTTCAGCAGAAAATGGCAGG - Intronic
1028587056 7:92462781-92462803 CATAGTGAGGAGAGAAAGGAAGG - Intergenic
1030877807 7:114837080-114837102 AATTTTGAGCAAAAAAAAGAAGG - Intergenic
1030910683 7:115245263-115245285 CATCTTGAGTTAAGAAAGGAAGG - Intergenic
1032284298 7:130529165-130529187 CATATTGTGGATAAAAAGGATGG + Intronic
1034010324 7:147522456-147522478 CATATTGTGAATAAAAAGGAAGG - Intronic
1034702001 7:153104616-153104638 CAACTTAATCAGAAAATGGAGGG - Intergenic
1034893689 7:154861461-154861483 CAGCTCGAGGAGGAAAAGGAAGG - Intronic
1036929032 8:12935192-12935214 CATTTATAGCAAAAAAAGGAGGG + Intergenic
1037005761 8:13777659-13777681 CATCTTCACCAGAAAACTGAGGG + Intergenic
1037584693 8:20268494-20268516 CATCTAGAGCAGCAAATGGGAGG - Intronic
1038070598 8:24008536-24008558 CACCCTGAGCAGAAATAGGGAGG - Intergenic
1038730763 8:30125561-30125583 CACATTAAGCAGAAAAAGTAAGG - Intronic
1038966858 8:32583297-32583319 CATCTTGAGCAGAAAAAGGAGGG - Intronic
1039419116 8:37420796-37420818 CCACTTGGGCAGAAAGAGGAGGG + Intergenic
1040076724 8:43244157-43244179 CATCTAGAACAGGACAAGGATGG - Intergenic
1041415817 8:57607791-57607813 CAGCTTGAGCAGACTAAGGCAGG + Intergenic
1042229080 8:66539149-66539171 CATCTAGCTCAGAAAAAGAATGG + Intergenic
1043336720 8:79185277-79185299 CAACATGGGCAGAAAAAGGAAGG - Intergenic
1044837794 8:96313119-96313141 CCTCTTCAGGAGAAAAAGGGTGG - Intronic
1045465412 8:102465003-102465025 CATTCTGAGCTGATAAAGGACGG - Intergenic
1046541135 8:115585437-115585459 AATTTTAAGTAGAAAAAGGAAGG + Intronic
1047378390 8:124328484-124328506 CATCTTCAGCAGAATATTGAGGG + Intronic
1047507285 8:125489776-125489798 CATTCTGAGGAGGAAAAGGAAGG - Intergenic
1047548579 8:125844203-125844225 CAGGGTGAGCAAAAAAAGGATGG - Intergenic
1047750693 8:127878270-127878292 CATCTTGAGCCTAAAGATGAAGG + Intergenic
1048083194 8:131150723-131150745 CAGCTTGAGCCATAAAAGGAAGG - Intergenic
1048104301 8:131390839-131390861 CATCTTGGTCAGAAAATCGAAGG - Intergenic
1048745485 8:137610261-137610283 CATCTTGGGCAAAAAAAAAATGG + Intergenic
1050280829 9:4048297-4048319 CATGTTTAGCAGAAGATGGAAGG + Intronic
1050640877 9:7666351-7666373 CTCCTTTAGCAGTAAAAGGATGG - Intergenic
1053014211 9:34652825-34652847 ATTCTTGAGCAGAGGAAGGAGGG - Intronic
1053582551 9:39421352-39421374 AATCTTGAGAAGAAAGAGCAAGG - Intergenic
1053846732 9:42246203-42246225 AATCTTGAGAAGAAAGAGCAAGG - Intergenic
1054104130 9:60980093-60980115 AATCTTGAGAAGAAAGAGCAAGG - Intergenic
1054146196 9:61562792-61562814 CATCTTCTGCAGATAAGGGAGGG + Intergenic
1054582218 9:66926753-66926775 AATCTTGAGAAGAAAGAGCAAGG + Intronic
1054927331 9:70601847-70601869 CATGATAAGCAGAAAAGGGAAGG - Intronic
1056806263 9:89731396-89731418 CATCTTCAGGAGAAAATGAAAGG - Intergenic
1059874507 9:118619407-118619429 CATCTTCAGAAGATAAAAGAAGG - Intergenic
1060500561 9:124150688-124150710 AATATTGAACAGAAAAAGCAAGG - Intergenic
1060753406 9:126190433-126190455 AATCTTGAGCATAACAAGTAAGG + Intergenic
1203488571 Un_GL000224v1:82154-82176 GATCTGGAGCACAAAAGGGAGGG + Intergenic
1203501192 Un_KI270741v1:24050-24072 GATCTGGAGCACAAAAGGGAGGG + Intergenic
1186491031 X:9972306-9972328 CAATTTGATCATAAAAAGGAAGG - Intergenic
1188868372 X:35342983-35343005 CAGCATGAACAGAAAAAGGGGGG + Intergenic
1189975978 X:46461603-46461625 GATCTGGAGCAGAAACAGGCGGG + Intronic
1189983090 X:46530097-46530119 GATCTGGAGCAGAAACAGGCGGG - Intronic
1190121725 X:47665843-47665865 CATGTTCAGGAGAAAATGGAGGG - Intergenic
1190125626 X:47702875-47702897 CATGTTCAGGAGAAAATGGAGGG - Intergenic
1190455806 X:50626883-50626905 CACCTTGCCCAGAAAAAGGCAGG + Intronic
1194568058 X:95518871-95518893 CAGGTTGCGGAGAAAAAGGAAGG + Intergenic
1196552877 X:117050905-117050927 GATGTTGTGGAGAAAAAGGAAGG + Intergenic
1197328801 X:125127804-125127826 CATATTGAGCACAAATTGGAAGG - Intergenic
1197807848 X:130414599-130414621 CCTCTGGAGAAGAAATAGGAAGG + Intergenic
1198143919 X:133835450-133835472 CTTTCTGTGCAGAAAAAGGATGG - Intronic
1198502042 X:137259951-137259973 CCTCTTGAGTGGAAAGAGGAAGG - Intergenic
1199559214 X:149145577-149145599 CATGTTGACCAGAAGTAGGATGG + Intergenic
1199636284 X:149815426-149815448 CATCTTGAGTTGAAACTGGAAGG - Intergenic
1199637654 X:149828619-149828641 CATCTTTAGGAAAAAAAGGGTGG + Intergenic
1199644331 X:149891452-149891474 CATCTTGAGTTGAAACTGGAAGG - Intergenic
1200427861 Y:3041331-3041353 CATCATGAGGAGAAAAAAAAAGG - Intergenic
1202073279 Y:21014724-21014746 CATCAGGAGTAGAAAATGGAAGG - Intergenic
1202077979 Y:21056578-21056600 CATCAGGAGTAGAAAATGGAAGG - Intergenic