ID: 1038973764

View in Genome Browser
Species Human (GRCh38)
Location 8:32668418-32668440
Sequence TGTAGGTTATTGAAGTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038973761_1038973764 20 Left 1038973761 8:32668375-32668397 CCTAGTTTCTATCACTAGTGGGT 0: 1
1: 0
2: 0
3: 5
4: 107
Right 1038973764 8:32668418-32668440 TGTAGGTTATTGAAGTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038973764 Original CRISPR TGTAGGTTATTGAAGTGTCA GGG Intronic
No off target data available for this crispr