ID: 1038975067

View in Genome Browser
Species Human (GRCh38)
Location 8:32686474-32686496
Sequence GAGACAGGGCCGGTAGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038975063_1038975067 -3 Left 1038975063 8:32686454-32686476 CCACAATGAGTGAAGTCAGGGAG 0: 1
1: 0
2: 0
3: 18
4: 132
Right 1038975067 8:32686474-32686496 GAGACAGGGCCGGTAGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038975067 Original CRISPR GAGACAGGGCCGGTAGTGAC AGG Intronic
No off target data available for this crispr