ID: 1038982763

View in Genome Browser
Species Human (GRCh38)
Location 8:32777472-32777494
Sequence GCAGGTAGACATGAGGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038982763_1038982775 23 Left 1038982763 8:32777472-32777494 CCCCATGCCTCATGTCTACCTGC No data
Right 1038982775 8:32777518-32777540 GGAAAACACCATAGTGAAGAGGG No data
1038982763_1038982774 22 Left 1038982763 8:32777472-32777494 CCCCATGCCTCATGTCTACCTGC No data
Right 1038982774 8:32777517-32777539 GGGAAAACACCATAGTGAAGAGG No data
1038982763_1038982776 24 Left 1038982763 8:32777472-32777494 CCCCATGCCTCATGTCTACCTGC No data
Right 1038982776 8:32777519-32777541 GAAAACACCATAGTGAAGAGGGG No data
1038982763_1038982771 1 Left 1038982763 8:32777472-32777494 CCCCATGCCTCATGTCTACCTGC No data
Right 1038982771 8:32777496-32777518 GCCTATTGGGGTCTCAAGAAAGG No data
1038982763_1038982773 2 Left 1038982763 8:32777472-32777494 CCCCATGCCTCATGTCTACCTGC No data
Right 1038982773 8:32777497-32777519 CCTATTGGGGTCTCAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038982763 Original CRISPR GCAGGTAGACATGAGGCATG GGG (reversed) Intergenic
No off target data available for this crispr