ID: 1038982770

View in Genome Browser
Species Human (GRCh38)
Location 8:32777490-32777512
Sequence TTGAGACCCCAATAGGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038982770_1038982775 5 Left 1038982770 8:32777490-32777512 CCTGCTGCCTATTGGGGTCTCAA No data
Right 1038982775 8:32777518-32777540 GGAAAACACCATAGTGAAGAGGG No data
1038982770_1038982774 4 Left 1038982770 8:32777490-32777512 CCTGCTGCCTATTGGGGTCTCAA No data
Right 1038982774 8:32777517-32777539 GGGAAAACACCATAGTGAAGAGG No data
1038982770_1038982776 6 Left 1038982770 8:32777490-32777512 CCTGCTGCCTATTGGGGTCTCAA No data
Right 1038982776 8:32777519-32777541 GAAAACACCATAGTGAAGAGGGG No data
1038982770_1038982778 22 Left 1038982770 8:32777490-32777512 CCTGCTGCCTATTGGGGTCTCAA No data
Right 1038982778 8:32777535-32777557 AGAGGGGCATCGAGTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038982770 Original CRISPR TTGAGACCCCAATAGGCAGC AGG (reversed) Intergenic
No off target data available for this crispr