ID: 1038982771

View in Genome Browser
Species Human (GRCh38)
Location 8:32777496-32777518
Sequence GCCTATTGGGGTCTCAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038982761_1038982771 12 Left 1038982761 8:32777461-32777483 CCTTTATATTCCCCCATGCCTCA No data
Right 1038982771 8:32777496-32777518 GCCTATTGGGGTCTCAAGAAAGG No data
1038982764_1038982771 0 Left 1038982764 8:32777473-32777495 CCCATGCCTCATGTCTACCTGCT No data
Right 1038982771 8:32777496-32777518 GCCTATTGGGGTCTCAAGAAAGG No data
1038982762_1038982771 2 Left 1038982762 8:32777471-32777493 CCCCCATGCCTCATGTCTACCTG No data
Right 1038982771 8:32777496-32777518 GCCTATTGGGGTCTCAAGAAAGG No data
1038982760_1038982771 13 Left 1038982760 8:32777460-32777482 CCCTTTATATTCCCCCATGCCTC No data
Right 1038982771 8:32777496-32777518 GCCTATTGGGGTCTCAAGAAAGG No data
1038982765_1038982771 -1 Left 1038982765 8:32777474-32777496 CCATGCCTCATGTCTACCTGCTG No data
Right 1038982771 8:32777496-32777518 GCCTATTGGGGTCTCAAGAAAGG No data
1038982763_1038982771 1 Left 1038982763 8:32777472-32777494 CCCCATGCCTCATGTCTACCTGC No data
Right 1038982771 8:32777496-32777518 GCCTATTGGGGTCTCAAGAAAGG No data
1038982766_1038982771 -6 Left 1038982766 8:32777479-32777501 CCTCATGTCTACCTGCTGCCTAT No data
Right 1038982771 8:32777496-32777518 GCCTATTGGGGTCTCAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038982771 Original CRISPR GCCTATTGGGGTCTCAAGAA AGG Intergenic
No off target data available for this crispr