ID: 1038982776

View in Genome Browser
Species Human (GRCh38)
Location 8:32777519-32777541
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038982765_1038982776 22 Left 1038982765 8:32777474-32777496 CCATGCCTCATGTCTACCTGCTG No data
Right 1038982776 8:32777519-32777541 GAAAACACCATAGTGAAGAGGGG No data
1038982764_1038982776 23 Left 1038982764 8:32777473-32777495 CCCATGCCTCATGTCTACCTGCT No data
Right 1038982776 8:32777519-32777541 GAAAACACCATAGTGAAGAGGGG No data
1038982766_1038982776 17 Left 1038982766 8:32777479-32777501 CCTCATGTCTACCTGCTGCCTAT No data
Right 1038982776 8:32777519-32777541 GAAAACACCATAGTGAAGAGGGG No data
1038982770_1038982776 6 Left 1038982770 8:32777490-32777512 CCTGCTGCCTATTGGGGTCTCAA No data
Right 1038982776 8:32777519-32777541 GAAAACACCATAGTGAAGAGGGG No data
1038982772_1038982776 -1 Left 1038982772 8:32777497-32777519 CCTATTGGGGTCTCAAGAAAGGG No data
Right 1038982776 8:32777519-32777541 GAAAACACCATAGTGAAGAGGGG No data
1038982762_1038982776 25 Left 1038982762 8:32777471-32777493 CCCCCATGCCTCATGTCTACCTG No data
Right 1038982776 8:32777519-32777541 GAAAACACCATAGTGAAGAGGGG No data
1038982763_1038982776 24 Left 1038982763 8:32777472-32777494 CCCCATGCCTCATGTCTACCTGC No data
Right 1038982776 8:32777519-32777541 GAAAACACCATAGTGAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038982776 Original CRISPR GAAAACACCATAGTGAAGAG GGG Intergenic
No off target data available for this crispr