ID: 1038984426

View in Genome Browser
Species Human (GRCh38)
Location 8:32793110-32793132
Sequence CTCAAATGGCAGAAGGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038984422_1038984426 5 Left 1038984422 8:32793082-32793104 CCTCTTCTGGGTTGCACACTGTT No data
Right 1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG No data
1038984421_1038984426 6 Left 1038984421 8:32793081-32793103 CCCTCTTCTGGGTTGCACACTGT No data
Right 1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038984426 Original CRISPR CTCAAATGGCAGAAGGGCCA AGG Intergenic
No off target data available for this crispr