ID: 1038984815

View in Genome Browser
Species Human (GRCh38)
Location 8:32797023-32797045
Sequence CTGACACATACTCCCACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038984815_1038984820 27 Left 1038984815 8:32797023-32797045 CCTACTGTGGGAGTATGTGTCAG No data
Right 1038984820 8:32797073-32797095 CCAAATTAAACTCCAGGAGATGG No data
1038984815_1038984816 3 Left 1038984815 8:32797023-32797045 CCTACTGTGGGAGTATGTGTCAG No data
Right 1038984816 8:32797049-32797071 TTTCCTCACTCAGAGTTCTTAGG No data
1038984815_1038984818 21 Left 1038984815 8:32797023-32797045 CCTACTGTGGGAGTATGTGTCAG No data
Right 1038984818 8:32797067-32797089 TTAGGACCAAATTAAACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038984815 Original CRISPR CTGACACATACTCCCACAGT AGG (reversed) Intergenic