ID: 1038987263

View in Genome Browser
Species Human (GRCh38)
Location 8:32825595-32825617
Sequence GGTAATGGAGCTATAGCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038987263_1038987267 -6 Left 1038987263 8:32825595-32825617 CCAATTGCTATAGCTCCATTACC No data
Right 1038987267 8:32825612-32825634 ATTACCTCTTAGGCTAAGTTGGG No data
1038987263_1038987266 -7 Left 1038987263 8:32825595-32825617 CCAATTGCTATAGCTCCATTACC No data
Right 1038987266 8:32825611-32825633 CATTACCTCTTAGGCTAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038987263 Original CRISPR GGTAATGGAGCTATAGCAAT TGG (reversed) Intergenic
No off target data available for this crispr