ID: 1038991547

View in Genome Browser
Species Human (GRCh38)
Location 8:32873748-32873770
Sequence GCATTTGCACAGATGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038991542_1038991547 26 Left 1038991542 8:32873699-32873721 CCATGAATATGAAGCCAGTTTTT No data
Right 1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG No data
1038991544_1038991547 12 Left 1038991544 8:32873713-32873735 CCAGTTTTTTGGTTTTTGATTTT No data
Right 1038991547 8:32873748-32873770 GCATTTGCACAGATGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038991547 Original CRISPR GCATTTGCACAGATGCAGCA GGG Intergenic
No off target data available for this crispr