ID: 1038991547 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:32873748-32873770 |
Sequence | GCATTTGCACAGATGCAGCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1038991542_1038991547 | 26 | Left | 1038991542 | 8:32873699-32873721 | CCATGAATATGAAGCCAGTTTTT | No data | ||
Right | 1038991547 | 8:32873748-32873770 | GCATTTGCACAGATGCAGCAGGG | No data | ||||
1038991544_1038991547 | 12 | Left | 1038991544 | 8:32873713-32873735 | CCAGTTTTTTGGTTTTTGATTTT | No data | ||
Right | 1038991547 | 8:32873748-32873770 | GCATTTGCACAGATGCAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1038991547 | Original CRISPR | GCATTTGCACAGATGCAGCA GGG | Intergenic | ||
No off target data available for this crispr |