ID: 1038992165

View in Genome Browser
Species Human (GRCh38)
Location 8:32879557-32879579
Sequence AGCAGAGATGTTCCTACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038992165_1038992167 2 Left 1038992165 8:32879557-32879579 CCCTTTGTAGGAACATCTCTGCT No data
Right 1038992167 8:32879582-32879604 AGCCTGTCCCTAGCATAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038992165 Original CRISPR AGCAGAGATGTTCCTACAAA GGG (reversed) Intergenic
No off target data available for this crispr