ID: 1038992167

View in Genome Browser
Species Human (GRCh38)
Location 8:32879582-32879604
Sequence AGCCTGTCCCTAGCATAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038992166_1038992167 1 Left 1038992166 8:32879558-32879580 CCTTTGTAGGAACATCTCTGCTG No data
Right 1038992167 8:32879582-32879604 AGCCTGTCCCTAGCATAGACAGG No data
1038992164_1038992167 7 Left 1038992164 8:32879552-32879574 CCAGTCCCTTTGTAGGAACATCT No data
Right 1038992167 8:32879582-32879604 AGCCTGTCCCTAGCATAGACAGG No data
1038992162_1038992167 11 Left 1038992162 8:32879548-32879570 CCTCCCAGTCCCTTTGTAGGAAC No data
Right 1038992167 8:32879582-32879604 AGCCTGTCCCTAGCATAGACAGG No data
1038992165_1038992167 2 Left 1038992165 8:32879557-32879579 CCCTTTGTAGGAACATCTCTGCT No data
Right 1038992167 8:32879582-32879604 AGCCTGTCCCTAGCATAGACAGG No data
1038992163_1038992167 8 Left 1038992163 8:32879551-32879573 CCCAGTCCCTTTGTAGGAACATC No data
Right 1038992167 8:32879582-32879604 AGCCTGTCCCTAGCATAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038992167 Original CRISPR AGCCTGTCCCTAGCATAGAC AGG Intergenic
No off target data available for this crispr