ID: 1038993696

View in Genome Browser
Species Human (GRCh38)
Location 8:32898124-32898146
Sequence CTCATTTTAACTTAATCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038993696_1038993700 7 Left 1038993696 8:32898124-32898146 CCTTAAGATTAAGTTAAAATGAG No data
Right 1038993700 8:32898154-32898176 AGAGTGATACCATAAGAAGGTGG No data
1038993696_1038993699 4 Left 1038993696 8:32898124-32898146 CCTTAAGATTAAGTTAAAATGAG No data
Right 1038993699 8:32898151-32898173 CAGAGAGTGATACCATAAGAAGG No data
1038993696_1038993701 8 Left 1038993696 8:32898124-32898146 CCTTAAGATTAAGTTAAAATGAG No data
Right 1038993701 8:32898155-32898177 GAGTGATACCATAAGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038993696 Original CRISPR CTCATTTTAACTTAATCTTA AGG (reversed) Intergenic
No off target data available for this crispr