ID: 1038993701

View in Genome Browser
Species Human (GRCh38)
Location 8:32898155-32898177
Sequence GAGTGATACCATAAGAAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1038993696_1038993701 8 Left 1038993696 8:32898124-32898146 CCTTAAGATTAAGTTAAAATGAG No data
Right 1038993701 8:32898155-32898177 GAGTGATACCATAAGAAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1038993701 Original CRISPR GAGTGATACCATAAGAAGGT GGG Intergenic
No off target data available for this crispr