ID: 1039001816

View in Genome Browser
Species Human (GRCh38)
Location 8:32989672-32989694
Sequence CTTTGCTTGGAGCAATGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039001810_1039001816 25 Left 1039001810 8:32989624-32989646 CCATTTTTGCTCTGTTTGCCTGT No data
Right 1039001816 8:32989672-32989694 CTTTGCTTGGAGCAATGTCCTGG No data
1039001814_1039001816 7 Left 1039001814 8:32989642-32989664 CCTGTGTTTGTGGGGTATTACTC 0: 27
1: 213
2: 507
3: 711
4: 769
Right 1039001816 8:32989672-32989694 CTTTGCTTGGAGCAATGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039001816 Original CRISPR CTTTGCTTGGAGCAATGTCC TGG Intergenic
No off target data available for this crispr