ID: 1039004705

View in Genome Browser
Species Human (GRCh38)
Location 8:33021489-33021511
Sequence AATTAACACTAAAACTTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039004705_1039004708 17 Left 1039004705 8:33021489-33021511 CCCTAAAAGTTTTAGTGTTAATT No data
Right 1039004708 8:33021529-33021551 TTTAGTTTGAGAGTTTTGAAAGG No data
1039004705_1039004709 20 Left 1039004705 8:33021489-33021511 CCCTAAAAGTTTTAGTGTTAATT No data
Right 1039004709 8:33021532-33021554 AGTTTGAGAGTTTTGAAAGGTGG No data
1039004705_1039004710 21 Left 1039004705 8:33021489-33021511 CCCTAAAAGTTTTAGTGTTAATT No data
Right 1039004710 8:33021533-33021555 GTTTGAGAGTTTTGAAAGGTGGG No data
1039004705_1039004711 26 Left 1039004705 8:33021489-33021511 CCCTAAAAGTTTTAGTGTTAATT No data
Right 1039004711 8:33021538-33021560 AGAGTTTTGAAAGGTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039004705 Original CRISPR AATTAACACTAAAACTTTTA GGG (reversed) Intergenic
No off target data available for this crispr