ID: 1039004711

View in Genome Browser
Species Human (GRCh38)
Location 8:33021538-33021560
Sequence AGAGTTTTGAAAGGTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039004706_1039004711 25 Left 1039004706 8:33021490-33021512 CCTAAAAGTTTTAGTGTTAATTT No data
Right 1039004711 8:33021538-33021560 AGAGTTTTGAAAGGTGGGTGTGG No data
1039004705_1039004711 26 Left 1039004705 8:33021489-33021511 CCCTAAAAGTTTTAGTGTTAATT No data
Right 1039004711 8:33021538-33021560 AGAGTTTTGAAAGGTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039004711 Original CRISPR AGAGTTTTGAAAGGTGGGTG TGG Intergenic
No off target data available for this crispr