ID: 1039007274

View in Genome Browser
Species Human (GRCh38)
Location 8:33053688-33053710
Sequence ACCTTGTACTGGTTTCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039007274_1039007281 28 Left 1039007274 8:33053688-33053710 CCCCTTGGAAACCAGTACAAGGT No data
Right 1039007281 8:33053739-33053761 CAACACAGTATTGAAAGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039007274 Original CRISPR ACCTTGTACTGGTTTCCAAG GGG (reversed) Intergenic