ID: 1039007918

View in Genome Browser
Species Human (GRCh38)
Location 8:33061358-33061380
Sequence CTGTGGCATGCATTGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039007918_1039007923 19 Left 1039007918 8:33061358-33061380 CCTCAGAACAATGCATGCCACAG No data
Right 1039007923 8:33061400-33061422 AATGTGATCATCAAGAAAGTTGG No data
1039007918_1039007920 -5 Left 1039007918 8:33061358-33061380 CCTCAGAACAATGCATGCCACAG No data
Right 1039007920 8:33061376-33061398 CACAGCCAGCCAAAAAATAATGG No data
1039007918_1039007924 24 Left 1039007918 8:33061358-33061380 CCTCAGAACAATGCATGCCACAG No data
Right 1039007924 8:33061405-33061427 GATCATCAAGAAAGTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039007918 Original CRISPR CTGTGGCATGCATTGTTCTG AGG (reversed) Intergenic
No off target data available for this crispr