ID: 1039007920

View in Genome Browser
Species Human (GRCh38)
Location 8:33061376-33061398
Sequence CACAGCCAGCCAAAAAATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039007917_1039007920 20 Left 1039007917 8:33061333-33061355 CCAGACAGTCTCAGTCATAGACT No data
Right 1039007920 8:33061376-33061398 CACAGCCAGCCAAAAAATAATGG No data
1039007918_1039007920 -5 Left 1039007918 8:33061358-33061380 CCTCAGAACAATGCATGCCACAG No data
Right 1039007920 8:33061376-33061398 CACAGCCAGCCAAAAAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039007920 Original CRISPR CACAGCCAGCCAAAAAATAA TGG Intergenic
No off target data available for this crispr