ID: 1039007924

View in Genome Browser
Species Human (GRCh38)
Location 8:33061405-33061427
Sequence GATCATCAAGAAAGTTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039007918_1039007924 24 Left 1039007918 8:33061358-33061380 CCTCAGAACAATGCATGCCACAG No data
Right 1039007924 8:33061405-33061427 GATCATCAAGAAAGTTGGTCTGG No data
1039007919_1039007924 7 Left 1039007919 8:33061375-33061397 CCACAGCCAGCCAAAAAATAATG No data
Right 1039007924 8:33061405-33061427 GATCATCAAGAAAGTTGGTCTGG No data
1039007921_1039007924 1 Left 1039007921 8:33061381-33061403 CCAGCCAAAAAATAATGGCAATG No data
Right 1039007924 8:33061405-33061427 GATCATCAAGAAAGTTGGTCTGG No data
1039007922_1039007924 -3 Left 1039007922 8:33061385-33061407 CCAAAAAATAATGGCAATGTGAT No data
Right 1039007924 8:33061405-33061427 GATCATCAAGAAAGTTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039007924 Original CRISPR GATCATCAAGAAAGTTGGTC TGG Intergenic
No off target data available for this crispr