ID: 1039008814

View in Genome Browser
Species Human (GRCh38)
Location 8:33070598-33070620
Sequence GAACACTCATTGGAATAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039008810_1039008814 9 Left 1039008810 8:33070566-33070588 CCATATGGTACATTGGTATGCAC No data
Right 1039008814 8:33070598-33070620 GAACACTCATTGGAATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039008814 Original CRISPR GAACACTCATTGGAATAAAC AGG Intergenic
No off target data available for this crispr