ID: 1039008814 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:33070598-33070620 |
| Sequence | GAACACTCATTGGAATAAAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039008810_1039008814 | 9 | Left | 1039008810 | 8:33070566-33070588 | CCATATGGTACATTGGTATGCAC | No data | ||
| Right | 1039008814 | 8:33070598-33070620 | GAACACTCATTGGAATAAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039008814 | Original CRISPR | GAACACTCATTGGAATAAAC AGG | Intergenic | ||
| No off target data available for this crispr | |||||