ID: 1039014914

View in Genome Browser
Species Human (GRCh38)
Location 8:33136612-33136634
Sequence AGCTTTATATTACAATACCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039014912_1039014914 27 Left 1039014912 8:33136562-33136584 CCTGGTTCTTTGTAAAATGAGCA No data
Right 1039014914 8:33136612-33136634 AGCTTTATATTACAATACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039014914 Original CRISPR AGCTTTATATTACAATACCA CGG Intergenic
No off target data available for this crispr