ID: 1039017698

View in Genome Browser
Species Human (GRCh38)
Location 8:33170728-33170750
Sequence TGGACACTGGTCAGTCTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039017698_1039017703 12 Left 1039017698 8:33170728-33170750 CCTAAAAGACTGACCAGTGTCCA No data
Right 1039017703 8:33170763-33170785 CCACTGTTTCATTTTCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039017698 Original CRISPR TGGACACTGGTCAGTCTTTT AGG (reversed) Intergenic
No off target data available for this crispr