ID: 1039017701 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:33170748-33170770 |
| Sequence | AACAGTGGCTTCATGACCTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039017701_1039017704 | 11 | Left | 1039017701 | 8:33170748-33170770 | CCACAGGTCATGAAGCCACTGTT | No data | ||
| Right | 1039017704 | 8:33170782-33170804 | CTGGACAGACTGCTCAGAACAGG | No data | ||||
| 1039017701_1039017703 | -8 | Left | 1039017701 | 8:33170748-33170770 | CCACAGGTCATGAAGCCACTGTT | No data | ||
| Right | 1039017703 | 8:33170763-33170785 | CCACTGTTTCATTTTCTTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039017701 | Original CRISPR | AACAGTGGCTTCATGACCTG TGG (reversed) | Intergenic | ||