ID: 1039017701 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:33170748-33170770 |
Sequence | AACAGTGGCTTCATGACCTG TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1039017701_1039017704 | 11 | Left | 1039017701 | 8:33170748-33170770 | CCACAGGTCATGAAGCCACTGTT | No data | ||
Right | 1039017704 | 8:33170782-33170804 | CTGGACAGACTGCTCAGAACAGG | No data | ||||
1039017701_1039017703 | -8 | Left | 1039017701 | 8:33170748-33170770 | CCACAGGTCATGAAGCCACTGTT | No data | ||
Right | 1039017703 | 8:33170763-33170785 | CCACTGTTTCATTTTCTTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1039017701 | Original CRISPR | AACAGTGGCTTCATGACCTG TGG (reversed) | Intergenic | ||