ID: 1039017702

View in Genome Browser
Species Human (GRCh38)
Location 8:33170763-33170785
Sequence CCAGAAAGAAAATGAAACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039017702_1039017704 -4 Left 1039017702 8:33170763-33170785 CCACTGTTTCATTTTCTTTCTGG No data
Right 1039017704 8:33170782-33170804 CTGGACAGACTGCTCAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039017702 Original CRISPR CCAGAAAGAAAATGAAACAG TGG (reversed) Intergenic