ID: 1039017703

View in Genome Browser
Species Human (GRCh38)
Location 8:33170763-33170785
Sequence CCACTGTTTCATTTTCTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039017694_1039017703 21 Left 1039017694 8:33170719-33170741 CCTCAACCCCCTAAAAGACTGAC No data
Right 1039017703 8:33170763-33170785 CCACTGTTTCATTTTCTTTCTGG No data
1039017698_1039017703 12 Left 1039017698 8:33170728-33170750 CCTAAAAGACTGACCAGTGTCCA No data
Right 1039017703 8:33170763-33170785 CCACTGTTTCATTTTCTTTCTGG No data
1039017701_1039017703 -8 Left 1039017701 8:33170748-33170770 CCACAGGTCATGAAGCCACTGTT No data
Right 1039017703 8:33170763-33170785 CCACTGTTTCATTTTCTTTCTGG No data
1039017696_1039017703 14 Left 1039017696 8:33170726-33170748 CCCCTAAAAGACTGACCAGTGTC No data
Right 1039017703 8:33170763-33170785 CCACTGTTTCATTTTCTTTCTGG No data
1039017697_1039017703 13 Left 1039017697 8:33170727-33170749 CCCTAAAAGACTGACCAGTGTCC No data
Right 1039017703 8:33170763-33170785 CCACTGTTTCATTTTCTTTCTGG No data
1039017700_1039017703 -1 Left 1039017700 8:33170741-33170763 CCAGTGTCCACAGGTCATGAAGC No data
Right 1039017703 8:33170763-33170785 CCACTGTTTCATTTTCTTTCTGG No data
1039017693_1039017703 22 Left 1039017693 8:33170718-33170740 CCCTCAACCCCCTAAAAGACTGA No data
Right 1039017703 8:33170763-33170785 CCACTGTTTCATTTTCTTTCTGG No data
1039017695_1039017703 15 Left 1039017695 8:33170725-33170747 CCCCCTAAAAGACTGACCAGTGT No data
Right 1039017703 8:33170763-33170785 CCACTGTTTCATTTTCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039017703 Original CRISPR CCACTGTTTCATTTTCTTTC TGG Intergenic